ID: 1131791925

View in Genome Browser
Species Human (GRCh38)
Location 15:95974266-95974288
Sequence CTGTCTTGCAAGGAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131791921_1131791925 12 Left 1131791921 15:95974231-95974253 CCAATAAAACTGAAAACAGCACG No data
Right 1131791925 15:95974266-95974288 CTGTCTTGCAAGGAGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131791925 Original CRISPR CTGTCTTGCAAGGAGGAGGT AGG Intergenic
No off target data available for this crispr