ID: 1131792637

View in Genome Browser
Species Human (GRCh38)
Location 15:95981624-95981646
Sequence AGTCACCCGCCACTAAGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131792637_1131792640 3 Left 1131792637 15:95981624-95981646 CCGTCCCTTAGTGGCGGGTGACT No data
Right 1131792640 15:95981650-95981672 CATGTGTGCTTAACACTTGCAGG No data
1131792637_1131792641 15 Left 1131792637 15:95981624-95981646 CCGTCCCTTAGTGGCGGGTGACT No data
Right 1131792641 15:95981662-95981684 ACACTTGCAGGTAGAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131792637 Original CRISPR AGTCACCCGCCACTAAGGGA CGG (reversed) Intergenic
No off target data available for this crispr