ID: 1131793732

View in Genome Browser
Species Human (GRCh38)
Location 15:95991874-95991896
Sequence GCTGATGGTGCAAAATATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131793724_1131793732 29 Left 1131793724 15:95991822-95991844 CCATGCCATACCCTGCACAGGGA No data
Right 1131793732 15:95991874-95991896 GCTGATGGTGCAAAATATCCTGG No data
1131793730_1131793732 -6 Left 1131793730 15:95991857-95991879 CCACATTCTATCATGTTGCTGAT No data
Right 1131793732 15:95991874-95991896 GCTGATGGTGCAAAATATCCTGG No data
1131793725_1131793732 24 Left 1131793725 15:95991827-95991849 CCATACCCTGCACAGGGAGAGTC No data
Right 1131793732 15:95991874-95991896 GCTGATGGTGCAAAATATCCTGG No data
1131793727_1131793732 18 Left 1131793727 15:95991833-95991855 CCTGCACAGGGAGAGTCACTTGG No data
Right 1131793732 15:95991874-95991896 GCTGATGGTGCAAAATATCCTGG No data
1131793726_1131793732 19 Left 1131793726 15:95991832-95991854 CCCTGCACAGGGAGAGTCACTTG No data
Right 1131793732 15:95991874-95991896 GCTGATGGTGCAAAATATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131793732 Original CRISPR GCTGATGGTGCAAAATATCC TGG Intergenic
No off target data available for this crispr