ID: 1131796633

View in Genome Browser
Species Human (GRCh38)
Location 15:96024367-96024389
Sequence TCCAGACTCCTTTGCAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131796627_1131796633 28 Left 1131796627 15:96024316-96024338 CCATCCATCATACTTCTAGTTGG No data
Right 1131796633 15:96024367-96024389 TCCAGACTCCTTTGCAATTCTGG No data
1131796629_1131796633 24 Left 1131796629 15:96024320-96024342 CCATCATACTTCTAGTTGGAGAG No data
Right 1131796633 15:96024367-96024389 TCCAGACTCCTTTGCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131796633 Original CRISPR TCCAGACTCCTTTGCAATTC TGG Intergenic
No off target data available for this crispr