ID: 1131796633 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:96024367-96024389 |
| Sequence | TCCAGACTCCTTTGCAATTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131796627_1131796633 | 28 | Left | 1131796627 | 15:96024316-96024338 | CCATCCATCATACTTCTAGTTGG | No data | ||
| Right | 1131796633 | 15:96024367-96024389 | TCCAGACTCCTTTGCAATTCTGG | No data | ||||
| 1131796629_1131796633 | 24 | Left | 1131796629 | 15:96024320-96024342 | CCATCATACTTCTAGTTGGAGAG | No data | ||
| Right | 1131796633 | 15:96024367-96024389 | TCCAGACTCCTTTGCAATTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131796633 | Original CRISPR | TCCAGACTCCTTTGCAATTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||