ID: 1131796635

View in Genome Browser
Species Human (GRCh38)
Location 15:96024373-96024395
Sequence CTCCTTTGCAATTCTGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131796629_1131796635 30 Left 1131796629 15:96024320-96024342 CCATCATACTTCTAGTTGGAGAG No data
Right 1131796635 15:96024373-96024395 CTCCTTTGCAATTCTGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131796635 Original CRISPR CTCCTTTGCAATTCTGGATA TGG Intergenic
No off target data available for this crispr