ID: 1131797851

View in Genome Browser
Species Human (GRCh38)
Location 15:96038096-96038118
Sequence CACGTTTGTTTTCCCCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131797851_1131797853 -5 Left 1131797851 15:96038096-96038118 CCCTGCGGGGGAAAACAAACGTG No data
Right 1131797853 15:96038114-96038136 ACGTGTATTCTAATTTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131797851 Original CRISPR CACGTTTGTTTTCCCCCGCA GGG (reversed) Intergenic
No off target data available for this crispr