ID: 1131798105

View in Genome Browser
Species Human (GRCh38)
Location 15:96041284-96041306
Sequence ACACTGGGCCTCTCAGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131798096_1131798105 22 Left 1131798096 15:96041239-96041261 CCCAATGCCTTTAAAGATGGTCC No data
Right 1131798105 15:96041284-96041306 ACACTGGGCCTCTCAGAGAGTGG No data
1131798097_1131798105 21 Left 1131798097 15:96041240-96041262 CCAATGCCTTTAAAGATGGTCCT No data
Right 1131798105 15:96041284-96041306 ACACTGGGCCTCTCAGAGAGTGG No data
1131798098_1131798105 15 Left 1131798098 15:96041246-96041268 CCTTTAAAGATGGTCCTGTACAA No data
Right 1131798105 15:96041284-96041306 ACACTGGGCCTCTCAGAGAGTGG No data
1131798102_1131798105 1 Left 1131798102 15:96041260-96041282 CCTGTACAAACAGGGGAACAACA No data
Right 1131798105 15:96041284-96041306 ACACTGGGCCTCTCAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131798105 Original CRISPR ACACTGGGCCTCTCAGAGAG TGG Intergenic
No off target data available for this crispr