ID: 1131798658

View in Genome Browser
Species Human (GRCh38)
Location 15:96046842-96046864
Sequence CACAAGGAAATACCTCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131798658 Original CRISPR CACAAGGAAATACCTCCAAA AGG Intergenic
901415005 1:9110602-9110624 CACAAGCAAACGCCTGCAAAAGG - Intronic
904948960 1:34220583-34220605 CACATGGAAATGCCTGCCAAAGG + Intergenic
907347914 1:53799206-53799228 CAAAAGGAAATCTGTCCAAAAGG - Intronic
910391496 1:86749845-86749867 CACAAGAAAATACATAGAAAAGG - Intergenic
911206149 1:95093184-95093206 CACAAGGAAGAACCTCCCAGAGG + Intergenic
912317374 1:108678430-108678452 ACCAAGGAAATACCTCCAAGAGG + Intergenic
913946434 1:125174170-125174192 CAAATGGAACCACCTCCAAATGG - Intergenic
919101956 1:193106378-193106400 CAAAAATAAATACCCCCAAAGGG + Intergenic
920032108 1:203043791-203043813 AACACTGAAATACTTCCAAATGG - Intronic
922158104 1:223055661-223055683 CTGAAGGAAAGACGTCCAAATGG + Intergenic
923195010 1:231657493-231657515 CAAAAGCAAAAACCTACAAATGG - Intronic
924206744 1:241719705-241719727 CATCAGGAAATACATCCTAATGG + Intronic
1062822553 10:545732-545754 CACAAAAAAATAGCTCAAAATGG - Intronic
1070615338 10:77965474-77965496 CACAATGAGATACCTCCTCACGG - Intergenic
1071371691 10:84957865-84957887 CACATGGTAATCCCTCCTAAAGG + Intergenic
1074863634 10:117532254-117532276 CAAAAGCAAAAACCCCCAAACGG - Intergenic
1074956215 10:118392714-118392736 CAAATGCAAATACGTCCAAAAGG + Intergenic
1077072775 11:684477-684499 AATAAGGAAATACGTCAAAAAGG + Intronic
1077662694 11:4083671-4083693 AACAAGGAAAGAACACCAAAAGG - Intronic
1082264039 11:50100348-50100370 CAAAAGGAAATACCTGCATTAGG - Intergenic
1083008734 11:59373694-59373716 CACAAAGAAACCCCTCCAGAAGG + Intergenic
1083106676 11:60365036-60365058 TACAGGGAAATAACTACAAAAGG + Intronic
1085934926 11:81129696-81129718 AACAAGGAAATAACCCCAACAGG - Intergenic
1087472843 11:98599711-98599733 ATCTAGGAAATACCTCAAAAGGG - Intergenic
1087989625 11:104732461-104732483 CATAATGAAATACCACCAACTGG + Intergenic
1088518861 11:110672353-110672375 CACAAAGAAAAACATACAAATGG + Intronic
1089088268 11:115842615-115842637 CACAAGGAAATAAATACAGATGG + Intergenic
1089527385 11:119106416-119106438 GGGAAGGAAATACCTGCAAAAGG - Intronic
1092803181 12:12191933-12191955 AACAAGGAAATGACTCCAGATGG + Intronic
1094264786 12:28544271-28544293 CACAAGGAAAAAACTCCAAAAGG - Intronic
1095128068 12:38505748-38505770 AACATGGAAATACTTCCAATTGG - Intergenic
1095993788 12:48060499-48060521 CAGAAGGAAATATTTTCAAATGG - Intronic
1096172522 12:49484261-49484283 CACAAGTAAATAGCTCCCCATGG - Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097983013 12:65753502-65753524 AACAAGCAAATACTTCCAATAGG + Intergenic
1098843654 12:75509111-75509133 TACAAGAAAATGCCTCCTAAGGG + Intronic
1106751042 13:32768382-32768404 CTCAACGAAATACCTCCCAAAGG + Intronic
1107188392 13:37550037-37550059 CACAAGGAAGTACCCCAATAGGG - Intergenic
1107977033 13:45699802-45699824 AACAAGGAAATAACTTAAAATGG - Intergenic
1107994259 13:45845511-45845533 CACAAAGAAATAGATCAAAAGGG - Intronic
1108496779 13:51033456-51033478 CCCAAGGAAAGAACTCCAGAAGG + Intergenic
1108968466 13:56341862-56341884 CACAAGGAAAGAGCTGCCAAAGG - Intergenic
1109967559 13:69721093-69721115 CACAAGGAAATTCCTTGTAAGGG - Intronic
1110869450 13:80433221-80433243 CAGAAGGAAATTCCTCTAAAAGG + Intergenic
1112727901 13:102326587-102326609 CACAAGAAAATAGCTCAAAAAGG + Intronic
1114081518 14:19204761-19204783 TACAAAGAAATACCTTCAACTGG - Intergenic
1115023766 14:28715325-28715347 TACAAGGAAATACCTGCAACTGG - Intergenic
1116513572 14:45778674-45778696 CACATGGAACAACCTCCAGATGG - Intergenic
1117791974 14:59350792-59350814 GAAAAGGAAAAACCTTCAAAAGG - Intronic
1120648579 14:87102867-87102889 CACAAGGAAATTCCTTGACAGGG - Intergenic
1121386801 14:93535098-93535120 CACATAGAAATAACTCCAAGTGG - Intronic
1125270121 15:37929551-37929573 CACAGGGAACTACATTCAAAAGG + Intronic
1127619411 15:60718848-60718870 CACAAGAAAATAATTCTAAAAGG + Intronic
1127942672 15:63715471-63715493 CAAAAGGAAAAAGATCCAAATGG - Intronic
1128613528 15:69091977-69091999 CACAAAGGAGCACCTCCAAATGG + Intergenic
1129001389 15:72337777-72337799 TACAAGGAAATAGCTCAAACTGG - Intronic
1130174074 15:81549163-81549185 AACAATGAAATACTTCCAATAGG + Intergenic
1131798658 15:96046842-96046864 CACAAGGAAATACCTCCAAAAGG + Intergenic
1133879967 16:9772359-9772381 CAAAACAAAATACCTCCAAAGGG - Intronic
1135415243 16:22263906-22263928 CACAGGGTAAGACCTCTAAATGG - Intronic
1136292417 16:29283647-29283669 CACAAAGAAATAACTCAAAATGG - Intergenic
1138314021 16:56052860-56052882 CAAAAGGCAAGACCTCCATAAGG - Intergenic
1141402349 16:83761205-83761227 CCCAAGCAAATAGGTCCAAAGGG - Intronic
1142098311 16:88257666-88257688 CACAAAGAAATAACTCAAAATGG - Intergenic
1145906056 17:28516901-28516923 CACAAGGACACACCTCCACAGGG + Intronic
1145906133 17:28517257-28517279 CACAGGGACACACCTCCACAGGG + Intronic
1145906147 17:28517324-28517346 CACAGGGACACACCTCCACAGGG + Intronic
1146750901 17:35378941-35378963 CACAAGGAAAGATATACAAATGG - Intergenic
1146780782 17:35670085-35670107 GACAAGAAAATAACTCCACATGG - Intronic
1146817762 17:35957217-35957239 CAAAAGGAAATACAGACAAATGG - Intergenic
1147778633 17:42922994-42923016 CCCAAGGAAATAACCCAAAAGGG - Intergenic
1149019144 17:51943412-51943434 CAAAAGTAAATATCTCTAAAGGG + Intronic
1149620571 17:58041851-58041873 GCCTAGGAAATACATCCAAATGG - Intergenic
1149854848 17:60073087-60073109 CACAGGGAACTACCTACAAAGGG + Intronic
1150314843 17:64159993-64160015 CACAAGGAGCTACCTCCATGGGG - Intronic
1152160945 17:78668285-78668307 CACCAGGAAATACACCCAACGGG - Intergenic
1152579208 17:81158650-81158672 CACCAAAAAATACCTCCAATGGG + Intronic
1153142729 18:1993417-1993439 CACAAAGAACTCCCTTCAAATGG + Intergenic
1155787283 18:29916302-29916324 CACAAGGAAATTCCTCATGAGGG - Intergenic
1156112158 18:33741737-33741759 TACATGGAAACACCACCAAATGG + Intronic
1156543237 18:37937968-37937990 CGCAAGGGAATACCTTGAAACGG - Intergenic
1157581250 18:48775520-48775542 CACAAGGAAAGCTCTCCAAGGGG + Intronic
1158626306 18:59074680-59074702 AACAAGGAAACACCATCAAAGGG - Intergenic
1162837237 19:13328609-13328631 CCCAAGGAAATACGCCCAAAGGG + Intronic
1164497267 19:28777845-28777867 CACAAGTACATTCCTCCAATAGG + Intergenic
924997581 2:377097-377119 CACATGAAAATACCTTCATAAGG + Intergenic
926790201 2:16563035-16563057 CAGATGGAAATATCTCAAAAAGG - Intronic
926828538 2:16934551-16934573 GGCAAGGAAATACCTCGAAGGGG - Intergenic
928158776 2:28901816-28901838 CAAAAAGAAATCCCTCCAATGGG - Intronic
930215840 2:48696329-48696351 CAGAAGGGACTACTTCCAAAAGG + Intronic
930342112 2:50130196-50130218 CACTAAGAAATTCCTCCAGATGG - Intronic
930712366 2:54560604-54560626 CTCAAGGAAATCCCTTCGAAAGG + Intronic
932172048 2:69566136-69566158 CACAAGGAATGACCCCCAAGAGG + Intronic
934138504 2:89020754-89020776 CACAAGGAAAGTCCTCCCTAGGG + Intergenic
934230739 2:90179798-90179820 CACAAGGAAAGTCCTCCCTAGGG - Intergenic
939265846 2:139871954-139871976 ATCACAGAAATACCTCCAAAAGG - Intergenic
939671425 2:145017376-145017398 CACAAGGAAATTTCTCAAAGAGG - Intergenic
939720091 2:145638292-145638314 CATAAGCAAAGACATCCAAATGG - Intergenic
941317457 2:164011468-164011490 CACAAAGACATTTCTCCAAATGG + Intergenic
943164927 2:184309266-184309288 CACAAAAGAATACCTCCACAAGG - Intergenic
943289366 2:186048950-186048972 CACAAGGGATCAACTCCAAAGGG + Intergenic
945612676 2:212024573-212024595 CAAAAGGAGATACATCAAAAAGG + Intronic
946606760 2:221413539-221413561 CTCAAGGCACTTCCTCCAAAAGG + Intergenic
946869998 2:224076460-224076482 CATAAAGAAATACCTGAAAAGGG - Intergenic
947193487 2:227536695-227536717 CAGAAGCACATACCTCCAAATGG - Exonic
948399850 2:237675770-237675792 CCTAAGGAAATACATCAAAATGG - Intronic
1169711505 20:8569813-8569835 TGGAAGGAAATACATCCAAAAGG + Intronic
1170322308 20:15113906-15113928 CAAGAGGAAAGATCTCCAAATGG - Intronic
1172301182 20:33851558-33851580 CACAGTGAAATACCTTCAACAGG - Intronic
1172460853 20:35117438-35117460 CACCATGGAAGACCTCCAAAGGG + Intronic
1172622076 20:36324480-36324502 CACAAAAAAATAACTCAAAATGG - Intronic
1180233269 21:46440986-46441008 TGGAAGGAAATACCCCCAAATGG - Exonic
1180499254 22:15917925-15917947 TACAAAGAAATACCTTCAACTGG + Intergenic
1180533666 22:16374416-16374438 CAAAAGGAATCACCTTCAAAAGG + Intergenic
1180703629 22:17795422-17795444 CACAACCAAACACATCCAAAAGG + Intronic
1180896283 22:19335600-19335622 CATAAAAATATACCTCCAAAGGG - Intronic
1182022302 22:27091224-27091246 CAGCAGGAAATAACTCCAAAGGG + Intergenic
1182081204 22:27530071-27530093 CACAAGAAAATACGTGCAAATGG - Intergenic
1182552151 22:31106351-31106373 CAGAAGGAAACACCTCAGAATGG + Intronic
1183695321 22:39418617-39418639 CACATGGAAATACCTGAAATGGG - Intronic
1203315977 22_KI270737v1_random:11380-11402 CAAAAGGAATCACCTTCAAAAGG - Intergenic
951662742 3:25087847-25087869 CAAAAGGAAATACCATCACAGGG - Intergenic
952504341 3:33994524-33994546 CACAAGGGAATATCTTCAAATGG + Intergenic
953375216 3:42422640-42422662 CACAAGGAAATAATTCCCAAAGG + Intergenic
953811029 3:46112998-46113020 CACAAGGAAAGACCCCCCTACGG - Intergenic
953866659 3:46589409-46589431 AAACAGGAAATAACTCCAAAAGG + Intronic
956965667 3:74456581-74456603 CACCAGCACATACCTCCTAATGG - Intronic
957432035 3:80123460-80123482 CACAACAAAATACCACCAACTGG + Intergenic
957782384 3:84835876-84835898 CAAAAGGAAATATGTGCAAAGGG + Intergenic
960078843 3:113518908-113518930 CATAATGAAATACCTTCAAATGG - Intergenic
960361421 3:116716508-116716530 AACAAGCAAATATCTCCAGAGGG + Intronic
961560792 3:127728075-127728097 AAGAAGGAAAAACCTACAAATGG - Intronic
963569944 3:146980891-146980913 CACAAGTAAATACCATGAAAAGG - Intergenic
966045162 3:175539894-175539916 CTCAAGGCAATACCTGCACATGG - Intronic
966671573 3:182532094-182532116 CAGAAGGAAATATTTCCAAAAGG - Intergenic
967183056 3:186923042-186923064 CACAAAGAAATTCCTCCAAAGGG - Intergenic
967837100 3:193974086-193974108 CCCAAAGAAATACCACAAAAAGG - Intergenic
968276411 3:197443848-197443870 CACATGAAAATACCACCATATGG + Intergenic
968311456 3:197687218-197687240 CAAAAGGAAACACTTCAAAATGG + Intronic
970034421 4:11716245-11716267 CACAAATAAATACCTTCATAAGG - Intergenic
970928742 4:21484027-21484049 TACAAAGAAATACCTGCAACTGG - Intronic
973197330 4:47461390-47461412 CACAAGCAACTGCTTCCAAATGG + Intronic
974055294 4:56977583-56977605 CATGAGGAAGTAGCTCCAAAGGG + Exonic
975267561 4:72388801-72388823 TACAAAGAAAAACCTGCAAAGGG + Intronic
975861623 4:78683303-78683325 TATATGAAAATACCTCCAAATGG - Intergenic
978001768 4:103564013-103564035 CACAAAAGAATAGCTCCAAATGG + Intergenic
978197878 4:105991631-105991653 CAAAAGGAAATGTCACCAAAAGG - Intronic
979637110 4:122968901-122968923 CACAAAGAAAGACATCTAAATGG - Intronic
980903048 4:138923307-138923329 CACCAGGTAATACAGCCAAAAGG + Intergenic
982691793 4:158556276-158556298 CTCAAAGAAAGACCTACAAATGG + Intronic
987685775 5:21198998-21199020 CACAAGGAAATACCTGGGATTGG + Intergenic
988031980 5:25773902-25773924 CTAAAGGAAATTCCTCCAGAAGG + Intergenic
988490086 5:31698787-31698809 CACGAGGAAGTACCTGCACAAGG + Intronic
989613652 5:43318496-43318518 TACAAAGAAATGCCTCCAACAGG - Intergenic
989811921 5:45687861-45687883 CTGGAGAAAATACCTCCAAAGGG - Intronic
989841532 5:46079035-46079057 CACAAGGAAGTTTCTCAAAAAGG - Intergenic
989853983 5:46255557-46255579 AACAAGGAAATATCTTCAGATGG - Intergenic
989855444 5:46282169-46282191 AACAAGGAAATATCTTCAGATGG - Intergenic
990848404 5:60172403-60172425 TTCTGGGAAATACCTCCAAAGGG + Intronic
991024228 5:62012662-62012684 AAAAATCAAATACCTCCAAAAGG + Intergenic
992353045 5:75950500-75950522 CTCAAGGAAAAACTTCAAAAAGG - Intergenic
994326163 5:98448135-98448157 CACACAAAAATACCTCCACAAGG + Intergenic
994404341 5:99325115-99325137 CACAAGAAATTACCTCAAAATGG + Intergenic
996573642 5:124959786-124959808 CATAAGGAAATACCACAAACTGG - Intergenic
997222879 5:132183771-132183793 CATAAAGAAATACCTGAAAATGG + Intergenic
998567472 5:143228995-143229017 CTCAAGAAAATACCACCAAATGG - Intronic
1002009476 5:176265606-176265628 AACTAGGAAATAACTCCAACAGG - Intronic
1002217251 5:177646689-177646711 AACTAGGAAATAACTCCAACAGG + Intergenic
1006086168 6:31597029-31597051 AACAAGGTAATACCTCTACAGGG + Intergenic
1006346699 6:33488231-33488253 CACAAGCATTCACCTCCAAATGG - Intergenic
1007110484 6:39310796-39310818 CTCCAGGTAATCCCTCCAAAAGG + Intronic
1011000005 6:82577323-82577345 AGCAAGGAAATACCTGCATATGG - Intergenic
1012918636 6:105198164-105198186 CACAAGGATATAGCTCCCATAGG + Intergenic
1013690989 6:112643385-112643407 CACAAAAAAATACCTCTAAATGG - Intergenic
1013820365 6:114146931-114146953 CATAAAGAAATACCTGCAACTGG - Intronic
1014216395 6:118756190-118756212 GAAAGGAAAATACCTCCAAAGGG + Intergenic
1014269091 6:119315809-119315831 GATAAGGAAATAACTACAAATGG - Intronic
1018510725 6:164521416-164521438 TAGAAGGAAATACCCGCAAATGG - Intergenic
1020389367 7:7641684-7641706 CACATAAAAATACCTTCAAACGG + Intronic
1020609909 7:10382581-10382603 CAAAAATAAATACATCCAAATGG + Intergenic
1023256261 7:38315672-38315694 CAGAAGGACATAGGTCCAAATGG - Intergenic
1025523504 7:61773427-61773449 AACAAGGAAATATCTTCAGATGG - Intergenic
1028520736 7:91727760-91727782 AACATGCAAATACCTCCAAATGG - Intronic
1028742187 7:94288211-94288233 CATATGAAAATACCTACAAATGG + Intergenic
1030091710 7:105863936-105863958 CACAAACAAAAAACTCCAAAAGG + Intronic
1030537559 7:110788272-110788294 AACAAGGAAGTACCTCCTAAGGG + Intronic
1035581621 8:743863-743885 CACATGCAAATACCAGCAAAAGG - Intergenic
1036237917 8:7057469-7057491 CACAAGGAACAACATTCAAAAGG + Intergenic
1037153391 8:15668664-15668686 CAAAACAAAATACTTCCAAAAGG + Intronic
1042611337 8:70604761-70604783 CAAAAGGAAATATATTCAAAAGG - Intronic
1045739772 8:105343531-105343553 CAGAAGGAAATAATTCCAGAGGG + Intronic
1045931813 8:107635859-107635881 CAAAAGGAAATGCCTGTAAAGGG - Intergenic
1048994139 8:139780513-139780535 CACAAAGAATTAGCTCAAAATGG + Intronic
1050246909 9:3699905-3699927 CAAAAGGAAATACCTTTATAGGG + Intergenic
1050600035 9:7241424-7241446 CAGAATGAAATACACCCAAAAGG - Intergenic
1050613010 9:7372664-7372686 CAAAAGGAAATACCAACCAATGG - Intergenic
1051342840 9:16127695-16127717 CAAAAGGAAATAACTCCCAGAGG + Intergenic
1051435461 9:17026369-17026391 AACAAGGAAATTACTTCAAACGG + Intergenic
1052367466 9:27628983-27629005 AAGAATGAAATATCTCCAAAAGG + Intergenic
1052432785 9:28388686-28388708 CACAAGGAAATACCATAAATAGG - Intronic
1056058707 9:82860085-82860107 AAAAAGGAAATACATCCATACGG - Intergenic
1059727134 9:117020071-117020093 TAGAAGGAAATACATCAAAAGGG + Intronic
1060708552 9:125832726-125832748 AACAAATAAATACCTGCAAAGGG - Intronic
1061671551 9:132191359-132191381 CCCTAGGAAATGTCTCCAAATGG - Intronic
1062077335 9:134597969-134597991 CACAAGGAATGACTTCCACAAGG - Intergenic
1062418071 9:136463649-136463671 CACAAAGAAATGCCTCAACAAGG + Intronic
1186141198 X:6575943-6575965 GACAAGGAGAAAACTCCAAAAGG + Intergenic
1187757598 X:22544855-22544877 CACAATGCAATTCCCCCAAAAGG - Intergenic
1188194688 X:27218519-27218541 CTCAAGAAAATATCTTCAAATGG - Intergenic
1190441848 X:50482557-50482579 CACAATAAAGAACCTCCAAAAGG - Intergenic
1194947646 X:100088280-100088302 CACAAGGAAATGATCCCAAATGG + Intergenic
1197714454 X:129696315-129696337 CATAAGAAAATACCACCAACTGG + Intergenic
1198085007 X:133274397-133274419 CAAAAGGAAATCTTTCCAAAAGG + Intergenic
1198226405 X:134649632-134649654 GAAGAGGAAATACATCCAAATGG + Intronic
1198709671 X:139487710-139487732 CATAAGGAAATACCCAAAAATGG + Intergenic
1199148456 X:144398857-144398879 CCCAAGAAAATAGCTTCAAATGG + Intergenic
1202181907 Y:22146995-22147017 CACAAAGACAGACCACCAAAAGG + Intergenic
1202209453 Y:22439407-22439429 CACAAAGACAGACCACCAAAAGG - Intergenic