ID: 1131800128

View in Genome Browser
Species Human (GRCh38)
Location 15:96059863-96059885
Sequence CTGTGAGGAAGTAAGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131800121_1131800128 13 Left 1131800121 15:96059827-96059849 CCACTGGAGCCTCGTGGAAGGGT No data
Right 1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG No data
1131800119_1131800128 14 Left 1131800119 15:96059826-96059848 CCCACTGGAGCCTCGTGGAAGGG No data
Right 1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG No data
1131800125_1131800128 -10 Left 1131800125 15:96059850-96059872 CCAGGAGAGCAAGCTGTGAGGAA No data
Right 1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG No data
1131800116_1131800128 19 Left 1131800116 15:96059821-96059843 CCACACCCACTGGAGCCTCGTGG No data
Right 1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG No data
1131800123_1131800128 4 Left 1131800123 15:96059836-96059858 CCTCGTGGAAGGGTCCAGGAGAG No data
Right 1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131800128 Original CRISPR CTGTGAGGAAGTAAGGAGGT TGG Intergenic
No off target data available for this crispr