ID: 1131800633

View in Genome Browser
Species Human (GRCh38)
Location 15:96065877-96065899
Sequence TTAGGCAACCTGGAAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131800627_1131800633 11 Left 1131800627 15:96065843-96065865 CCCAAAGCTGTATACTTAATCAA No data
Right 1131800633 15:96065877-96065899 TTAGGCAACCTGGAAAAGACAGG No data
1131800628_1131800633 10 Left 1131800628 15:96065844-96065866 CCAAAGCTGTATACTTAATCAAT No data
Right 1131800633 15:96065877-96065899 TTAGGCAACCTGGAAAAGACAGG No data
1131800626_1131800633 12 Left 1131800626 15:96065842-96065864 CCCCAAAGCTGTATACTTAATCA No data
Right 1131800633 15:96065877-96065899 TTAGGCAACCTGGAAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131800633 Original CRISPR TTAGGCAACCTGGAAAAGAC AGG Intergenic
No off target data available for this crispr