ID: 1131803359

View in Genome Browser
Species Human (GRCh38)
Location 15:96095815-96095837
Sequence CAGCATATGGGTCAGAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131803359_1131803367 18 Left 1131803359 15:96095815-96095837 CCCATTCTCTGACCCATATGCTG No data
Right 1131803367 15:96095856-96095878 CTCATTGTTTCCCCAGGACTTGG No data
1131803359_1131803366 12 Left 1131803359 15:96095815-96095837 CCCATTCTCTGACCCATATGCTG No data
Right 1131803366 15:96095850-96095872 GATCTACTCATTGTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131803359 Original CRISPR CAGCATATGGGTCAGAGAAT GGG (reversed) Intergenic
No off target data available for this crispr