ID: 1131803364

View in Genome Browser
Species Human (GRCh38)
Location 15:96095827-96095849
Sequence TAGCCTCTTACCCAGCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131803364_1131803367 6 Left 1131803364 15:96095827-96095849 CCCATATGCTGGGTAAGAGGCTA No data
Right 1131803367 15:96095856-96095878 CTCATTGTTTCCCCAGGACTTGG No data
1131803364_1131803366 0 Left 1131803364 15:96095827-96095849 CCCATATGCTGGGTAAGAGGCTA No data
Right 1131803366 15:96095850-96095872 GATCTACTCATTGTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131803364 Original CRISPR TAGCCTCTTACCCAGCATAT GGG (reversed) Intergenic
No off target data available for this crispr