ID: 1131803365

View in Genome Browser
Species Human (GRCh38)
Location 15:96095828-96095850
Sequence CTAGCCTCTTACCCAGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131803365_1131803367 5 Left 1131803365 15:96095828-96095850 CCATATGCTGGGTAAGAGGCTAG No data
Right 1131803367 15:96095856-96095878 CTCATTGTTTCCCCAGGACTTGG No data
1131803365_1131803366 -1 Left 1131803365 15:96095828-96095850 CCATATGCTGGGTAAGAGGCTAG No data
Right 1131803366 15:96095850-96095872 GATCTACTCATTGTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131803365 Original CRISPR CTAGCCTCTTACCCAGCATA TGG (reversed) Intergenic
No off target data available for this crispr