ID: 1131803366

View in Genome Browser
Species Human (GRCh38)
Location 15:96095850-96095872
Sequence GATCTACTCATTGTTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131803364_1131803366 0 Left 1131803364 15:96095827-96095849 CCCATATGCTGGGTAAGAGGCTA No data
Right 1131803366 15:96095850-96095872 GATCTACTCATTGTTTCCCCAGG No data
1131803360_1131803366 11 Left 1131803360 15:96095816-96095838 CCATTCTCTGACCCATATGCTGG No data
Right 1131803366 15:96095850-96095872 GATCTACTCATTGTTTCCCCAGG No data
1131803365_1131803366 -1 Left 1131803365 15:96095828-96095850 CCATATGCTGGGTAAGAGGCTAG No data
Right 1131803366 15:96095850-96095872 GATCTACTCATTGTTTCCCCAGG No data
1131803359_1131803366 12 Left 1131803359 15:96095815-96095837 CCCATTCTCTGACCCATATGCTG No data
Right 1131803366 15:96095850-96095872 GATCTACTCATTGTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131803366 Original CRISPR GATCTACTCATTGTTTCCCC AGG Intergenic
No off target data available for this crispr