ID: 1131806434

View in Genome Browser
Species Human (GRCh38)
Location 15:96127027-96127049
Sequence GAGTGCCAAGCTGGAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131806434_1131806439 15 Left 1131806434 15:96127027-96127049 CCCTGAGCTCCAGCTTGGCACTC No data
Right 1131806439 15:96127065-96127087 TGCATTGTGTTCCTTCGGCTAGG No data
1131806434_1131806438 10 Left 1131806434 15:96127027-96127049 CCCTGAGCTCCAGCTTGGCACTC No data
Right 1131806438 15:96127060-96127082 TTGAATGCATTGTGTTCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131806434 Original CRISPR GAGTGCCAAGCTGGAGCTCA GGG (reversed) Intergenic