ID: 1131806774

View in Genome Browser
Species Human (GRCh38)
Location 15:96130705-96130727
Sequence CACGTTCTGATACTACTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131806774_1131806778 15 Left 1131806774 15:96130705-96130727 CCAGACAGTAGTATCAGAACGTG No data
Right 1131806778 15:96130743-96130765 TTGAAAGAACATGGGATGTTTGG No data
1131806774_1131806780 17 Left 1131806774 15:96130705-96130727 CCAGACAGTAGTATCAGAACGTG No data
Right 1131806780 15:96130745-96130767 GAAAGAACATGGGATGTTTGGGG No data
1131806774_1131806776 6 Left 1131806774 15:96130705-96130727 CCAGACAGTAGTATCAGAACGTG No data
Right 1131806776 15:96130734-96130756 CATGGAAACTTGAAAGAACATGG No data
1131806774_1131806779 16 Left 1131806774 15:96130705-96130727 CCAGACAGTAGTATCAGAACGTG No data
Right 1131806779 15:96130744-96130766 TGAAAGAACATGGGATGTTTGGG No data
1131806774_1131806777 7 Left 1131806774 15:96130705-96130727 CCAGACAGTAGTATCAGAACGTG No data
Right 1131806777 15:96130735-96130757 ATGGAAACTTGAAAGAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131806774 Original CRISPR CACGTTCTGATACTACTGTC TGG (reversed) Intergenic
No off target data available for this crispr