ID: 1131808397

View in Genome Browser
Species Human (GRCh38)
Location 15:96147381-96147403
Sequence CTGTGAGTATCTTAAGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131808397_1131808399 5 Left 1131808397 15:96147381-96147403 CCCAATTCTTAAGATACTCACAG No data
Right 1131808399 15:96147409-96147431 TTTCACTGAATGCCTAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131808397 Original CRISPR CTGTGAGTATCTTAAGAATT GGG (reversed) Intergenic
No off target data available for this crispr