ID: 1131812556

View in Genome Browser
Species Human (GRCh38)
Location 15:96187589-96187611
Sequence GCGTCATAAACAATAACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131812554_1131812556 10 Left 1131812554 15:96187556-96187578 CCTGGCAGAGACAGTATAACTCA No data
Right 1131812556 15:96187589-96187611 GCGTCATAAACAATAACTAAAGG No data
1131812553_1131812556 11 Left 1131812553 15:96187555-96187577 CCCTGGCAGAGACAGTATAACTC No data
Right 1131812556 15:96187589-96187611 GCGTCATAAACAATAACTAAAGG No data
1131812551_1131812556 30 Left 1131812551 15:96187536-96187558 CCAAGACTACTGACTGAAACCCT No data
Right 1131812556 15:96187589-96187611 GCGTCATAAACAATAACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131812556 Original CRISPR GCGTCATAAACAATAACTAA AGG Intergenic
No off target data available for this crispr