ID: 1131814656 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:96209605-96209627 |
| Sequence | GTTGACTGAGTGCTGACGGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131814656_1131814663 | 26 | Left | 1131814656 | 15:96209605-96209627 | CCGCCCGTCAGCACTCAGTCAAC | No data | ||
| Right | 1131814663 | 15:96209654-96209676 | CAGATAAGTTGTATTTGATCTGG | No data | ||||
| 1131814656_1131814659 | -5 | Left | 1131814656 | 15:96209605-96209627 | CCGCCCGTCAGCACTCAGTCAAC | No data | ||
| Right | 1131814659 | 15:96209623-96209645 | TCAACATCAGCACATACCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131814656 | Original CRISPR | GTTGACTGAGTGCTGACGGG CGG (reversed) | Intergenic | ||