ID: 1131814656

View in Genome Browser
Species Human (GRCh38)
Location 15:96209605-96209627
Sequence GTTGACTGAGTGCTGACGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131814656_1131814663 26 Left 1131814656 15:96209605-96209627 CCGCCCGTCAGCACTCAGTCAAC No data
Right 1131814663 15:96209654-96209676 CAGATAAGTTGTATTTGATCTGG No data
1131814656_1131814659 -5 Left 1131814656 15:96209605-96209627 CCGCCCGTCAGCACTCAGTCAAC No data
Right 1131814659 15:96209623-96209645 TCAACATCAGCACATACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131814656 Original CRISPR GTTGACTGAGTGCTGACGGG CGG (reversed) Intergenic