ID: 1131815182

View in Genome Browser
Species Human (GRCh38)
Location 15:96214730-96214752
Sequence GAGATTTGTCCCTCCTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131815182_1131815184 -1 Left 1131815182 15:96214730-96214752 CCTCCTTAGGAGGGACAAATCTC No data
Right 1131815184 15:96214752-96214774 CATCCCTAGCATCTGACTCAAGG No data
1131815182_1131815188 19 Left 1131815182 15:96214730-96214752 CCTCCTTAGGAGGGACAAATCTC No data
Right 1131815188 15:96214772-96214794 AGGCAGTTGCTTCATTTCCAGGG No data
1131815182_1131815187 18 Left 1131815182 15:96214730-96214752 CCTCCTTAGGAGGGACAAATCTC No data
Right 1131815187 15:96214771-96214793 AAGGCAGTTGCTTCATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131815182 Original CRISPR GAGATTTGTCCCTCCTAAGG AGG (reversed) Intergenic
No off target data available for this crispr