ID: 1131815510

View in Genome Browser
Species Human (GRCh38)
Location 15:96217407-96217429
Sequence CCAGAGGGTTGATGGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131815510_1131815521 14 Left 1131815510 15:96217407-96217429 CCCATTTTCCATCAACCCTCTGG No data
Right 1131815521 15:96217444-96217466 TGTTTCCAAGTCTCATGGATAGG No data
1131815510_1131815520 9 Left 1131815510 15:96217407-96217429 CCCATTTTCCATCAACCCTCTGG No data
Right 1131815520 15:96217439-96217461 TCTTTTGTTTCCAAGTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131815510 Original CRISPR CCAGAGGGTTGATGGAAAAT GGG (reversed) Intergenic
No off target data available for this crispr