ID: 1131821105

View in Genome Browser
Species Human (GRCh38)
Location 15:96274525-96274547
Sequence ATGCTGTCTTTGGGGAAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131821100_1131821105 10 Left 1131821100 15:96274492-96274514 CCTAATGTTTAGAATGTGCTGTG No data
Right 1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131821105 Original CRISPR ATGCTGTCTTTGGGGAAAGC CGG Intergenic
No off target data available for this crispr