ID: 1131828347

View in Genome Browser
Species Human (GRCh38)
Location 15:96337547-96337569
Sequence CCCCATCGAAACCCTCATCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131828340_1131828347 23 Left 1131828340 15:96337501-96337523 CCTCAGTCATAGAGCAATTGTTT 0: 1
1: 0
2: 2
3: 15
4: 170
Right 1131828347 15:96337547-96337569 CCCCATCGAAACCCTCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 93
1131828339_1131828347 26 Left 1131828339 15:96337498-96337520 CCTCCTCAGTCATAGAGCAATTG 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1131828347 15:96337547-96337569 CCCCATCGAAACCCTCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 93
1131828343_1131828347 -5 Left 1131828343 15:96337529-96337551 CCGTTTGGTAGGTAAAACCCCCA 0: 2
1: 0
2: 1
3: 3
4: 73
Right 1131828347 15:96337547-96337569 CCCCATCGAAACCCTCATCCGGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131828347 Original CRISPR CCCCATCGAAACCCTCATCC GGG Exonic
900726908 1:4222560-4222582 CCCCATCGAGATCCTCAGCTTGG - Intergenic
901980673 1:13031752-13031774 CTCTCTCGAAACCCTCATCTTGG + Exonic
902001416 1:13197179-13197201 CTCTCTCGAAACCCTCATCTTGG - Exonic
902020652 1:13342884-13342906 CTCTCTCGAAACCCTCATCTTGG - Exonic
902621098 1:17651594-17651616 CCCAAAAGAAACCCCCATCCAGG + Intronic
902919337 1:19657037-19657059 CCCCATCCCCACCCCCATCCTGG + Exonic
903049095 1:20587676-20587698 CCCCATCCAAACTCTCCTGCTGG + Intergenic
904862045 1:33545909-33545931 CCCCATTTGAACCCTCAGCCTGG - Intronic
905298015 1:36966733-36966755 CCTCATCAGAACCCTCTTCCAGG + Intronic
916760153 1:167808576-167808598 CCCCTTCAAAACTGTCATCCTGG - Intergenic
920431446 1:205921619-205921641 CACCTTCCACACCCTCATCCTGG - Exonic
923992723 1:239456693-239456715 CACCCTGGATACCCTCATCCAGG - Intronic
1065807745 10:29410112-29410134 CCCCACAGAAACCCTCAAGCGGG - Intergenic
1067979881 10:51073632-51073654 CCCCTTCCAAACTCTCATCGGGG - Intronic
1070071580 10:73095897-73095919 CCCCATTGAAACATACATCCGGG + Intronic
1073427249 10:103462804-103462826 GCCCATCCAAAGCCACATCCCGG + Intergenic
1075328926 10:121558278-121558300 ACCCTTCAAAACCCTCAACCTGG + Intronic
1075919572 10:126199168-126199190 CCCAAACGAAACCTTCATTCAGG - Intronic
1078549341 11:12269619-12269641 CTCCCACGAAGCCCTCATCCTGG - Intergenic
1086615056 11:88806709-88806731 TCCCTTCAACACCCTCATCCTGG + Intronic
1089009631 11:115121933-115121955 CCCCACCCAAGCCCTCCTCCAGG - Intergenic
1090610600 11:128467327-128467349 CACCAGCGACACCCACATCCAGG + Intronic
1091316816 11:134620032-134620054 CCCCCTGGAAATTCTCATCCTGG + Intergenic
1092918345 12:13208390-13208412 CCCCAGGGAAACCCTCAGTCTGG - Intronic
1093769171 12:22999381-22999403 CCCCATCGCAAGCCTCATGGAGG + Intergenic
1096070539 12:48773277-48773299 CCCCAAGGAAACCCTAGTCCTGG - Intronic
1103505587 12:121440785-121440807 CCCCACAGAAACCCCCAGCCTGG + Intronic
1106501296 13:30331466-30331488 CCCCATGGAAACCCTGAGCAAGG + Intergenic
1113871073 13:113560332-113560354 CCCCATCCAGACCCTCGACCCGG - Intergenic
1114999156 14:28401041-28401063 AGCCATGGAAACTCTCATCCTGG + Intergenic
1121926999 14:97936475-97936497 CCCCATCGAAACTCTAATCAAGG - Intronic
1129316710 15:74749686-74749708 CTCCATCTCAACCCTCAGCCTGG + Intronic
1129672600 15:77615642-77615664 CCGCATCAAAACGCTCAACCAGG - Exonic
1131828347 15:96337547-96337569 CCCCATCGAAACCCTCATCCGGG + Exonic
1132618555 16:853992-854014 GCCCATCCAACCCCACATCCTGG + Exonic
1134075863 16:11290819-11290841 CCCTATCGCTCCCCTCATCCAGG - Intronic
1136475579 16:30511113-30511135 CCCCATCAACATCCTCATCCAGG + Exonic
1137571742 16:49570892-49570914 CCCCATTGCCACCCTCCTCCAGG + Intronic
1139150831 16:64380838-64380860 CCCCATTGAAGCCAGCATCCTGG - Intergenic
1142352184 16:89585594-89585616 CTCCATCGCAGCCCACATCCAGG - Intronic
1145254688 17:21316175-21316197 CCCCATGGGGACCCTCCTCCTGG - Intergenic
1145321909 17:21771790-21771812 CCCCATGGGGACCCTCCTCCTGG + Intergenic
1152367213 17:79863241-79863263 CCCCATCCTAACCCTGTTCCTGG + Intergenic
1157578054 18:48757005-48757027 CCCCACCGACACCTTCATCTTGG - Intronic
1158444212 18:57504794-57504816 CCCCATGAAAGCCCCCATCCTGG + Intergenic
1159138865 18:64369085-64369107 AGCCATGGAAACTCTCATCCTGG + Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925910743 2:8572027-8572049 CTCCATCAACAGCCTCATCCTGG + Intergenic
926381668 2:12296578-12296600 TCCCAGCGAAAGCCTCATCAAGG + Intergenic
929511584 2:42569056-42569078 CCTCCACGAAACCCTCATCGGGG + Intronic
935759655 2:106309490-106309512 TCAAATCAAAACCCTCATCCTGG - Intergenic
938237386 2:129717347-129717369 CCCCTTGGCATCCCTCATCCTGG - Intergenic
947704744 2:232265177-232265199 CCCCTTTGAAACCCACCTCCTGG + Intronic
1168760719 20:347855-347877 TCCCATGGCAACCCTCGTCCCGG + Intronic
1178048314 21:28720754-28720776 GCCCATCAAAACCTCCATCCAGG - Intergenic
1181939455 22:26464141-26464163 CCCCATCAACATCCTCATCCAGG + Exonic
1183070658 22:35393773-35393795 CCCCAACGAAAAGCACATCCAGG + Exonic
1184183617 22:42848777-42848799 CCCCAGTGAAACCCACCTCCTGG + Intronic
1184894815 22:47400746-47400768 CACCATCTACACCCACATCCTGG - Intergenic
954745077 3:52783115-52783137 CCCCACCCTTACCCTCATCCAGG - Exonic
954991406 3:54843665-54843687 CCCCAACAAAACCATCCTCCAGG - Intronic
969257370 4:6011467-6011489 CCCCATGGCACCCCACATCCGGG + Intergenic
969642158 4:8405386-8405408 CCCCATCCAACCCTTCAGCCAGG + Intronic
984914335 4:184707497-184707519 CCCCAGCCAAACCCCCATGCTGG + Intronic
985277137 4:188248751-188248773 CCCAATAGACACCCCCATCCAGG - Intergenic
985703035 5:1385104-1385126 CCCCATCGTTAAGCTCATCCTGG - Intergenic
985721242 5:1490345-1490367 TCCCATAGGGACCCTCATCCGGG - Intronic
988540678 5:32106006-32106028 CCCCACCCAAACCCTCACCATGG - Intronic
998295790 5:140967615-140967637 CACCATTGGAGCCCTCATCCGGG - Exonic
998337211 5:141383703-141383725 CCCCATTGACTCCCTCGTCCAGG - Exonic
998337769 5:141388688-141388710 CGGCATTGACACCCTCATCCTGG - Exonic
998342066 5:141427082-141427104 CCGCATTGACACCCTCATCCTGG - Intronic
1001883915 5:175271177-175271199 TCCCATGGAAAACCCCATCCGGG + Intergenic
1002464728 5:179401497-179401519 CCCCATCTAACCCCTCTTCCTGG + Intergenic
1006301292 6:33194714-33194736 CCCCATCGACACCTTCCTCATGG - Exonic
1009325137 6:62339433-62339455 CCCCAGAGAACCCCACATCCTGG + Intergenic
1011202664 6:84854549-84854571 CCTCATCGAAACCAGCATCTTGG + Intergenic
1017743398 6:157426614-157426636 CCTCATCCAAACCCACAGCCAGG - Intronic
1022010599 7:26304981-26305003 CCCCATCCACCCCCTCCTCCAGG - Intronic
1029606602 7:101602852-101602874 CCCCATCCCACCCCTCACCCTGG + Intergenic
1034201064 7:149283270-149283292 CCCCATCAAAACCCACAGGCTGG - Exonic
1034829064 7:154293504-154293526 CCCCATCAACTCCTTCATCCTGG + Intronic
1044663727 8:94615421-94615443 CCCCATCGACACCACCAGCCTGG - Intergenic
1048225048 8:132577133-132577155 CCCCACTGAAACCACCATCCTGG + Intronic
1049253439 8:141601342-141601364 CCCCAGTGCAACCCACATCCAGG - Intergenic
1049398872 8:142415951-142415973 CCCCACCCAGCCCCTCATCCCGG + Intergenic
1054895317 9:70303490-70303512 CCACATGAAAACCATCATCCAGG - Intronic
1058358558 9:104112700-104112722 CCCCATCTAAAACCCCATCTAGG + Intronic
1060524935 9:124315198-124315220 CCCCAGGGAAACCCGCTTCCTGG + Intronic
1061262551 9:129488248-129488270 CCCCACCGCACCCCTCTTCCCGG - Intergenic
1061888439 9:133605160-133605182 CCCTAGCGAAAACCTCTTCCAGG - Intergenic
1062379604 9:136280853-136280875 CCCCATCCAACCCCTAACCCTGG - Intergenic
1185457073 X:316581-316603 CCCCAGCCAAATCCTCCTCCTGG - Intronic
1188058969 X:25577051-25577073 CCCCATCCTAACCCCCACCCTGG + Intergenic
1188465553 X:30476262-30476284 CCCCATCTAAACTCCCATTCTGG - Intergenic
1191668252 X:63725179-63725201 CCCCACCGTGACCCTCCTCCTGG + Intronic
1199951945 X:152714497-152714519 CCCCATCCAGATCCCCATCCGGG + Intergenic
1199957738 X:152753951-152753973 CCCCATCCAGATCCCCATCCGGG - Intergenic
1200932015 Y:8705726-8705748 TCCCATAGAAACACTCAGCCTGG + Intergenic