ID: 1131828512

View in Genome Browser
Species Human (GRCh38)
Location 15:96339461-96339483
Sequence TCTCACAGACTGAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1041
Summary {0: 2, 1: 0, 2: 9, 3: 105, 4: 925}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131828512_1131828518 -2 Left 1131828512 15:96339461-96339483 CCCTTTACCTTCAGTCTGTGAGA 0: 2
1: 0
2: 9
3: 105
4: 925
Right 1131828518 15:96339482-96339504 GAGCATGACCACAGGGTCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 143
1131828512_1131828517 -3 Left 1131828512 15:96339461-96339483 CCCTTTACCTTCAGTCTGTGAGA 0: 2
1: 0
2: 9
3: 105
4: 925
Right 1131828517 15:96339481-96339503 AGAGCATGACCACAGGGTCAAGG 0: 1
1: 0
2: 1
3: 24
4: 252
1131828512_1131828515 -10 Left 1131828512 15:96339461-96339483 CCCTTTACCTTCAGTCTGTGAGA 0: 2
1: 0
2: 9
3: 105
4: 925
Right 1131828515 15:96339474-96339496 GTCTGTGAGAGCATGACCACAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1131828512_1131828516 -9 Left 1131828512 15:96339461-96339483 CCCTTTACCTTCAGTCTGTGAGA 0: 2
1: 0
2: 9
3: 105
4: 925
Right 1131828516 15:96339475-96339497 TCTGTGAGAGCATGACCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 170
1131828512_1131828520 13 Left 1131828512 15:96339461-96339483 CCCTTTACCTTCAGTCTGTGAGA 0: 2
1: 0
2: 9
3: 105
4: 925
Right 1131828520 15:96339497-96339519 GTCAAGGGAATCTTTTCCATTGG 0: 1
1: 0
2: 2
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131828512 Original CRISPR TCTCACAGACTGAAGGTAAA GGG (reversed) Exonic
900699546 1:4036240-4036262 TCACATAAACTTAAGGTAAAGGG + Intergenic
900734600 1:4289936-4289958 ACCCACAGACTCAAAGTAAAGGG - Intergenic
906914847 1:49997331-49997353 TCACAAAAACTCAAGGTAAAGGG + Intronic
907001422 1:50862669-50862691 TCACACAAACTTAAGGTAAAGGG + Intronic
908093867 1:60716559-60716581 TCTTAAAGACTGGAGGTAAATGG + Intergenic
908473151 1:64464129-64464151 TCTCCCAGTTTGAAGGGAAATGG + Intergenic
908662503 1:66452308-66452330 GCTAACAGATTGAAGGAAAAGGG - Intergenic
908712819 1:67036640-67036662 TCACATAGACTGAAAATAAAGGG - Intronic
908862128 1:68500896-68500918 TCACATAAACTTAAGGTAAAGGG + Intergenic
908883625 1:68761383-68761405 TCACATAAACTTAAGGTAAAGGG + Intergenic
908890596 1:68843358-68843380 TCACATAAACTTAAGGTAAAGGG - Intergenic
908968985 1:69802580-69802602 ACTTACAAACTGAAGGTAAAGGG - Intronic
908981985 1:69969406-69969428 TCACATAAACTTAAGGTAAAGGG + Intronic
909065307 1:70929248-70929270 TTTTACAGTTTGAAGGTAAATGG - Intronic
909235058 1:73142505-73142527 TCACATAAACTTAAGGTAAAGGG - Intergenic
909712756 1:78671736-78671758 TCTTACAGACTCAAGGTAAAGGG - Intergenic
909720646 1:78765602-78765624 ACACACAGACTGAAAATAAAGGG - Intergenic
910064658 1:83139206-83139228 ACCCACAGACTCAAAGTAAAGGG - Intergenic
910232917 1:85005022-85005044 TCACATAAACTTAAGGTAAAGGG + Intronic
910456385 1:87401698-87401720 TTTCCCAGACTGAAGAAAAAAGG - Intergenic
910801076 1:91146933-91146955 ACACACAGACTGAAAATAAAGGG - Intergenic
910919386 1:92327521-92327543 TCACATAAACTTAAGGTAAAGGG - Intronic
910951747 1:92655600-92655622 TAATACAGACTGAAGGAAAAAGG + Intronic
911322516 1:96432521-96432543 TCACAAAAACTTAAGGTAAAGGG - Intergenic
911689338 1:100814283-100814305 TCACATAAACTTAAGGTAAAGGG + Intergenic
912040267 1:105381531-105381553 ACTCACAGGCTCAAAGTAAATGG - Intergenic
913035617 1:114962525-114962547 TCACATAAACTTAAGGTAAAGGG - Intronic
913151556 1:116048876-116048898 TCACATAAACTTAAGGTAAAGGG + Intronic
913236377 1:116787181-116787203 TCACATAAACTTAAGGTAAAGGG + Intergenic
913337301 1:117720544-117720566 TCACATAAACTTAAGGTAAAGGG + Intergenic
913588007 1:120295264-120295286 TCACATAAACTTAAGGTAAAGGG - Intergenic
913620178 1:120603105-120603127 TCACATAAACTTAAGGTAAAGGG + Intergenic
914464303 1:147912445-147912467 TCTCAGAGAATGAAAGTAATTGG - Intergenic
914570023 1:148907137-148907159 TCACATAAACTTAAGGTAAAGGG - Intronic
914602806 1:149223132-149223154 TCACATAAACTTAAGGTAAAGGG + Intergenic
915750791 1:158208239-158208261 ACTTATAGACTGAAAGTAAAGGG - Intergenic
915800899 1:158792259-158792281 TCTTATAGGCTCAAGGTAAAGGG - Intergenic
915844116 1:159245449-159245471 ACACACAGACTGAAAGTAAAGGG - Intergenic
915880202 1:159662360-159662382 ACACACAGACTGAAAGTGAAGGG - Intergenic
915907963 1:159893053-159893075 ACTCTCAGACTGAAGACAAAGGG - Intronic
917058263 1:171007565-171007587 GCTCCCAAACTGAAGCTAAAAGG + Intronic
917351398 1:174081893-174081915 TCACATAAACTTAAGGTAAAGGG + Intergenic
918227181 1:182494621-182494643 TCTCTGATACTGATGGTAAATGG + Intronic
918867293 1:189919151-189919173 ACCCACAGGCTGAAGGTAAATGG - Intergenic
918914997 1:190623779-190623801 TCTCCCAGGCTGAAGTTCAACGG + Intergenic
918917960 1:190669792-190669814 TGTCACATAGTGAAGGAAAAAGG + Intergenic
919147120 1:193650360-193650382 ACTAACAGACTGAAAATAAAAGG - Intergenic
919214289 1:194532693-194532715 TCACATAAACTTAAGGTAAAGGG - Intergenic
919249553 1:195035010-195035032 TCTTACAGACTCATGGTAAAGGG - Intergenic
919374254 1:196772874-196772896 ACTCATAGTCTGAAAGTAAAAGG - Intergenic
919397780 1:197071888-197071910 TCACATAAACTTAAGGTAAAGGG + Intergenic
919571722 1:199257227-199257249 TCACATAAACTTAAGGTAAAGGG - Intergenic
920990018 1:210927835-210927857 TCACATAAACTTAAGGTAAAGGG + Intronic
921002574 1:211058864-211058886 ACACACAGACTGAAAATAAAGGG + Intronic
921762701 1:218935450-218935472 TCACATAAACTTAAGGTAAAGGG - Intergenic
921843088 1:219849108-219849130 TCACACAAACTTAAGATAAAGGG + Intronic
921999976 1:221467207-221467229 TCACATAAACTTAAGGTAAAGGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923458939 1:234190344-234190366 TCACATAAACTTAAGGTAAAGGG + Intronic
923691740 1:236200707-236200729 TCACATAAACTTAAGGTAAAGGG - Intronic
923960926 1:239083004-239083026 TCACATAAACTTAAGGTAAATGG - Intergenic
924193051 1:241576126-241576148 TCACACAAACTCAAGGTAGAGGG - Intronic
924691736 1:246358090-246358112 TCACATAAACTTAAGGTAAAGGG + Intronic
1062929638 10:1344461-1344483 ACTTACAGAGGGAAGGTAAAAGG + Intronic
1063550009 10:7022941-7022963 ACACACAGACTGAAGGTAAAGGG + Intergenic
1063952118 10:11233322-11233344 TTTCAGAGACTGCAAGTAAAGGG + Intronic
1064557023 10:16557583-16557605 TCACATAAACTTAAGGTAAATGG - Intergenic
1064704709 10:18059803-18059825 TCTCACAGAGGGAAGGAGAAAGG - Intergenic
1065158082 10:22891574-22891596 TCCTATAGACTCAAGGTAAAGGG - Intergenic
1065418352 10:25514371-25514393 TCACATAAACTTAAGGTAAAGGG - Intronic
1065462582 10:25984388-25984410 TCGCAAAAACTTAAGGTAAAGGG + Intronic
1066651074 10:37655707-37655729 TCACATAAACTTAAGGTAAAGGG + Intergenic
1066979281 10:42396697-42396719 GGTCACAGACTGAAGATGAATGG + Intergenic
1067234017 10:44432920-44432942 TCACATAAACTTAAGGTAAAGGG - Intergenic
1068122654 10:52799524-52799546 TCACATAAACTGAAGGTGAAGGG - Intergenic
1068326277 10:55491856-55491878 TCTCAAACACTGAAGTTGAATGG - Intronic
1068383468 10:56291647-56291669 ACACATAGACTGAAAGTAAAGGG - Intergenic
1068436538 10:56999433-56999455 TCTTATAGACTCAAGGTAAAGGG + Intergenic
1068924830 10:62525224-62525246 TCACATAAACTTAAGGTAAAGGG - Intronic
1069129387 10:64680281-64680303 TCACATAAACTTAAGGTAAAGGG - Intergenic
1071023995 10:81091064-81091086 TCACATAAACTTAAGGTAAAGGG - Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071939036 10:90567156-90567178 TTTCATAGACTGAAAGTGAAGGG - Intergenic
1072076918 10:91985593-91985615 TCTCACATACTGATGGTCAGAGG - Intronic
1073742834 10:106429162-106429184 TGTCACAAACTGAAAATAAAGGG + Intergenic
1073900277 10:108213281-108213303 CCTCACAAACTTGAGGTAAAAGG - Intergenic
1074226671 10:111491222-111491244 ACACATAGACTGAAGATAAAGGG - Intergenic
1074466651 10:113689271-113689293 TCTTATAGAATCAAGGTAAAGGG - Intronic
1074492474 10:113951531-113951553 TCTCCCAGACTGAAGTACAATGG + Intergenic
1074635534 10:115311971-115311993 TCTTATAGACTCAAGGTAAAGGG - Intronic
1075366423 10:121894376-121894398 ACAAACAGATTGAAGGTAAAAGG + Intronic
1076112184 10:127869036-127869058 TCATATAGACTCAAGGTAAAGGG - Intergenic
1076665399 10:132086724-132086746 TCACATAAACTTAAGGTAAAGGG - Intergenic
1076813458 10:132901078-132901100 AGACACAGATTGAAGGTAAAAGG - Intronic
1077774992 11:5260653-5260675 TCACATAAACTTAAGGTAAAGGG + Intronic
1078288794 11:9985229-9985251 TCACATAAACTTAAGGTAAAGGG + Intronic
1078296914 11:10080738-10080760 ATGTACAGACTGAAGGTAAAGGG + Intronic
1078416504 11:11170582-11170604 TCACAGAGACTGAAGGTCATTGG + Intergenic
1078570346 11:12452556-12452578 ACTCACAGACTCAAGGTCATGGG - Intronic
1078584309 11:12568208-12568230 TTTCACAAACTGAAGGTTCATGG - Intergenic
1078876220 11:15401040-15401062 ACACACAGACTGGAGGTAAAGGG - Intergenic
1079179699 11:18179534-18179556 TCACATAAACTTAAGGTAAAGGG + Intronic
1079463987 11:20711247-20711269 TCACACTAACTAAAGGTAAAGGG - Intronic
1079891480 11:26060740-26060762 ACACACAGACTGAAAGTTAAGGG - Intergenic
1080203153 11:29697639-29697661 TCACATAGACTTAAGGTAAAGGG - Intergenic
1080842355 11:35996571-35996593 TTTCACAAACTGAAGGTCTATGG - Intronic
1080863887 11:36176162-36176184 TCACATAAACTTAAGGTAAAGGG - Intronic
1080978240 11:37367766-37367788 GCTTACAGATTTAAGGTAAAAGG + Intergenic
1081009568 11:37792224-37792246 TCAGACAAACTTAAGGTAAAGGG - Intergenic
1082104178 11:48202029-48202051 TCACATAAACTTAAGGTAAAGGG + Intergenic
1082165435 11:48944808-48944830 TAGCTCAGACTGAAGATAAAGGG - Intergenic
1082169265 11:48982555-48982577 TAGCTCAGACTGAAGATAAAGGG + Intergenic
1082611156 11:55299132-55299154 TAGCTCAGACTGAAGATAAAGGG + Intergenic
1082658775 11:55884540-55884562 TAGCTCAGACTGAAGATAAAGGG - Intronic
1084235269 11:67784074-67784096 TCTCACAGACTGAGTTAAAAAGG - Intergenic
1084252711 11:67912942-67912964 ACACACAGACTGAAAGTGAAGGG + Intergenic
1084428064 11:69096383-69096405 TCTGCCAGCCTGCAGGTAAAGGG - Intergenic
1084820155 11:71683088-71683110 ACACACAGACTGAAAGTGAAGGG - Intergenic
1085240334 11:75048310-75048332 TCACATAAACTTAAGGTAAAGGG - Intergenic
1085248202 11:75121582-75121604 ACACACAGACTGAAAATAAAGGG + Intronic
1085340833 11:75730413-75730435 TCATATAGCCTGAAGGTAAAGGG + Intronic
1085369550 11:75987774-75987796 TCTCCCAGACTGGAGTAAAATGG + Intronic
1085917359 11:80905285-80905307 CCACACAAACTTAAGGTAAAGGG + Intergenic
1086156039 11:83666948-83666970 GATCACAGACTCAAGGCAAATGG - Intronic
1086264783 11:84984760-84984782 TCACATAAACTTAAGGTAAAGGG + Intronic
1086297796 11:85390129-85390151 TCACATAAACTTAAGGTAAAGGG + Intronic
1086696565 11:89854064-89854086 TAGCTCAGACTGAAGATAAAGGG - Intergenic
1086709593 11:89990426-89990448 TAGCTCAGACTGAAGATAAAGGG + Intergenic
1086756377 11:90568299-90568321 TCTCACTCACAGAAGTTAAATGG - Intergenic
1086828481 11:91529259-91529281 ACACACAGACTGAAAATAAAGGG + Intergenic
1086997705 11:93377480-93377502 TCACACAAACTTAAGGTAAAGGG - Intronic
1087220150 11:95538348-95538370 TGTCAGATAATGAAGGTAAAGGG - Intergenic
1087344634 11:96955965-96955987 ACTCAAAGCCTTAAGGTAAATGG + Intergenic
1087434914 11:98102382-98102404 TCACACAGACTGGAGTGAAACGG - Intergenic
1087460735 11:98443330-98443352 ACACACAGACTGAACATAAAAGG - Intergenic
1087608680 11:100407864-100407886 TCTAACAAACTGAAGATAAGTGG + Intergenic
1087676074 11:101163513-101163535 ACTTATAGACTGAAAGTAAAGGG - Intergenic
1087688747 11:101295685-101295707 TCACATAAACTTAAGGTAAAGGG - Intergenic
1087720650 11:101661698-101661720 ACACACAGACTGAAAATAAATGG - Intronic
1087866013 11:103228049-103228071 TCTCATAAACTTAAGGTAAAGGG - Intronic
1088182109 11:107124186-107124208 ACACACAGACTGAAAATAAAGGG + Intergenic
1088273272 11:108057627-108057649 TGTAACAGACTGAAGGACAAAGG + Intronic
1088331487 11:108657596-108657618 TATCACTGACTCAAGGAAAAAGG + Intergenic
1088372266 11:109104748-109104770 TCACAGAAACTTAAGGTAAAGGG - Intergenic
1088387261 11:109273499-109273521 TCACAGAAACTTAAGGTAAAGGG - Intergenic
1088552647 11:111029008-111029030 TCTTATAAACTCAAGGTAAAGGG + Intergenic
1088951346 11:114573491-114573513 TCACATAAACTTAAGGTAAAGGG + Intronic
1089423547 11:118350538-118350560 TCTGACACACTGTAGGGAAAAGG - Exonic
1090466879 11:126942844-126942866 TCTCAGAGAGAGAAGGAAAAGGG - Intronic
1090545442 11:127761337-127761359 TCACATAAACTTAAGGTAAAGGG + Intergenic
1090682873 11:129079877-129079899 TCACATAAACTTAAGGTAAAGGG + Intronic
1090756903 11:129800046-129800068 TCACATAAACTTAAGGTAAAGGG + Intergenic
1091380981 12:59194-59216 TCACATAAACTTAAGGTAAAGGG + Intergenic
1091709102 12:2724924-2724946 GCTGACAGCCTGTAGGTAAATGG - Intergenic
1091764489 12:3109879-3109901 TCTTAGAGACTGTAGGTAAAAGG + Intronic
1092060248 12:5544754-5544776 TCACATAGACTTAAGGTAAAAGG + Intronic
1092627597 12:10344164-10344186 TATCAGAGGCTGAAGGTACAGGG - Intergenic
1093105141 12:15077151-15077173 TCACACAGACTTGAAGTAAAGGG + Intergenic
1093135972 12:15451109-15451131 TCACATAAACTTAAGGTAAAGGG + Intronic
1093608391 12:21123172-21123194 TCACATAAACTTAAGGTAAAAGG + Intronic
1093941041 12:25054803-25054825 TCTCAAAGATTGAATTTAAAGGG - Intronic
1093994043 12:25622442-25622464 GCTCACAAACTCAAGGTCAAGGG - Intronic
1094263252 12:28525959-28525981 TCACACAAACTTAAGGTAAAGGG - Intronic
1095176519 12:39098043-39098065 TCACATAAACTTAAGGTAAAGGG + Intergenic
1095190615 12:39253970-39253992 ATGCACAGACTGAAAGTAAAGGG - Intergenic
1095777016 12:46021289-46021311 TCTTACAAACTCAAGGTAAAGGG - Intergenic
1095786393 12:46113034-46113056 TTTTATAGACTCAAGGTAAAGGG + Intergenic
1096897388 12:54837452-54837474 TCTTATAGACTTGAGGTAAAGGG - Intronic
1096956642 12:55532913-55532935 TCACATAAACTGAAGGTAAAGGG + Intergenic
1097537183 12:60887370-60887392 TCACATAAACTTAAGGTAAAGGG - Intergenic
1097581455 12:61462188-61462210 TCATATAAACTGAAGGTAAAGGG + Intergenic
1097906778 12:64928544-64928566 TCACATAAACTTAAGGTAAAGGG - Intergenic
1098142636 12:67466540-67466562 ACACACAGACTGAAAATAAATGG - Intergenic
1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG + Intronic
1098518817 12:71411482-71411504 TGTCATAAACTTAAGGTAAAGGG + Intronic
1098840130 12:75467870-75467892 ACTCACAGGCTCAAAGTAAAGGG + Intergenic
1098852438 12:75612882-75612904 TCACATAAACTTAAGGTAAATGG + Intergenic
1099016527 12:77349915-77349937 TGTCACAGGCTGAGGGTTAATGG + Intergenic
1099042181 12:77669476-77669498 TCACATAAACTTAAGGTAAAGGG + Intergenic
1099224545 12:79953962-79953984 ACACACAGGCTGAAGGTGAAGGG - Intergenic
1099382541 12:81972654-81972676 TCACATAAACTTAAGGTAAAAGG + Intergenic
1099719333 12:86341318-86341340 TCTGACAGACTGAAGATTGAAGG - Intronic
1100420768 12:94430886-94430908 ACACATAGACTGAAAGTAAAGGG + Intronic
1100697047 12:97106165-97106187 TCACACAAACTTAAGGTAAAGGG - Intergenic
1100706497 12:97205626-97205648 TCACATAAACTTAAGGTAAAGGG + Intergenic
1100970648 12:100066152-100066174 TCACACAAACTTAAGGTAAAGGG + Intronic
1101099337 12:101376684-101376706 TCACCCAGACTGGAGTTAAATGG + Intronic
1101226937 12:102697382-102697404 ACACATAGACTGAAAGTAAAGGG + Intergenic
1101290587 12:103363620-103363642 TCACACAAACTTAAGGTAAAGGG + Intronic
1101298051 12:103446635-103446657 TCACATAAACTTAAGGTAAAGGG + Intronic
1101747791 12:107556970-107556992 TCGCACAGACTGAAGTGCAATGG - Intronic
1104078779 12:125412312-125412334 TCTCTAAGACTGAAGGGAGAGGG + Intronic
1104179129 12:126361054-126361076 ACTCACAGAAGGTAGGTAAATGG - Intergenic
1104741658 12:131179990-131180012 TCTTATAGACTCAAGGTAAAGGG + Intergenic
1104870954 12:131995200-131995222 TCTCACACACTCAAGATGAACGG - Intronic
1104870962 12:131995327-131995349 TCTCACACACTCAAGATGAACGG - Intronic
1104870971 12:131995454-131995476 TCTCACACACTCAAGATGAACGG - Intronic
1104870975 12:131995518-131995540 TCTCACACACTCAAGATGAACGG - Intronic
1104870992 12:131995772-131995794 TCTCACACACTCAAGATGAACGG - Intronic
1105454602 13:20528505-20528527 TCTCACTGAGTTAAGGAAAAAGG + Intergenic
1105478744 13:20753784-20753806 ACATACAGACTGAAAGTAAAGGG - Intronic
1105709890 13:22997258-22997280 TCTGTCAGACTGAAATTAAAGGG + Intergenic
1105735269 13:23262279-23262301 TCTCATAGACTCAAGGTTAAGGG + Intronic
1105859614 13:24397522-24397544 TCATACAGACTGAAAGTGAAGGG + Intergenic
1106060163 13:26282840-26282862 TCACATAAACTTAAGGTAAAAGG + Intronic
1106814870 13:33396498-33396520 TGTAACAGACTGAAGTTTAAAGG - Intergenic
1107555980 13:41517142-41517164 CCAAACAGACTGAGGGTAAAAGG - Intergenic
1108134541 13:47341048-47341070 TCACATAAACTTAAGGTAAAGGG + Intergenic
1108134745 13:47343526-47343548 TCACATAAACTTAAGGTAAAGGG + Intergenic
1108181817 13:47847728-47847750 TCTTACAGACTGAAGGTTTGTGG + Intergenic
1108249024 13:48546216-48546238 TCTCAAACACTGAAAGAAAAAGG - Intergenic
1108307338 13:49151441-49151463 ACATACAGACTGAAAGTAAAGGG - Intronic
1108831842 13:54488853-54488875 TCACATAAACTTAAGGTAAAGGG + Intergenic
1108858665 13:54826861-54826883 ACACACAGACTGAAAATAAAGGG + Intergenic
1109618082 13:64863160-64863182 TCACATAAACTTAAGGTAAAGGG - Intergenic
1109822439 13:67675637-67675659 TCTCATGAACTTAAGGTAAAGGG - Intergenic
1109824414 13:67698738-67698760 TCTCATAAACTTAAGGTAAAGGG + Intergenic
1110488466 13:76073630-76073652 ACTTACAGGCTGAAGGTGAAGGG + Intergenic
1110755935 13:79173922-79173944 TCACATAAACTTAAGGTAAAGGG + Intergenic
1110888016 13:80663119-80663141 CCTTACAGACTCAAGATAAAGGG - Intergenic
1110946167 13:81421277-81421299 TCTTATAGACTCAAGGTAAAGGG - Intergenic
1111130657 13:83970816-83970838 ACTCATAGACTGAAAATAAAGGG + Intergenic
1111145070 13:84168660-84168682 ATCCACAGACTTAAGGTAAAGGG - Intergenic
1111283218 13:86053820-86053842 TCACATAAACTTAAGGTAAAGGG + Intergenic
1111292344 13:86186010-86186032 TCTCACAGAGCAAAGGAAAAAGG - Intergenic
1111389049 13:87567361-87567383 ACTCATAGACTGAAAGCAAAGGG + Intergenic
1111748156 13:92295824-92295846 TCACACAAACTTAAGGTAAAGGG - Intronic
1111752291 13:92348244-92348266 ACACACAGACTGAAAATAAAGGG + Intronic
1112087191 13:96043640-96043662 TCACATAAACTTAAGGTAAAGGG + Intronic
1112141701 13:96650898-96650920 TATCACAGACTAAAGTTAAAAGG - Intronic
1112242794 13:97698643-97698665 TCTATAAGACTAAAGGTAAAAGG + Intergenic
1112527425 13:100164877-100164899 TCACAGAGACAGAAAGTAAAAGG - Intronic
1112618581 13:101031807-101031829 ACACACAGACTGAAAATAAAGGG - Intergenic
1112980685 13:105381277-105381299 TCTGATAGACTTAAGGTAATAGG + Intergenic
1113240490 13:108331104-108331126 TCACATAAACTTAAGGTAAAGGG + Intergenic
1113845434 13:113386674-113386696 TCACATAAACTTAAGGTAAAGGG - Intergenic
1113992921 14:16042501-16042523 ACTCACTAAATGAAGGTAAAGGG - Intergenic
1114129119 14:19769189-19769211 ACACACAGACTAAAAGTAAAGGG - Intronic
1114698393 14:24649483-24649505 TCTTATAGACTCAAGGCAAAGGG + Intergenic
1114756493 14:25266134-25266156 TCACATAAACTTAAGGTAAAGGG - Intergenic
1114783499 14:25567730-25567752 ACACACAGACTGAAAATAAAGGG - Intergenic
1115329333 14:32178219-32178241 AGACACAGACTGAAGGTAAAGGG - Intergenic
1115350440 14:32389207-32389229 TCGCACAAACTTAAGGTAAAGGG - Intronic
1115789715 14:36865330-36865352 TGTTACAGAGGGAAGGTAAATGG - Intronic
1115937920 14:38576056-38576078 TCACATAAACTTAAGGTAAAGGG - Intergenic
1116335701 14:43653406-43653428 TCACACAAACTTAGGGTAAAGGG + Intergenic
1116747787 14:48843751-48843773 TCTCACAAACTCAAAGTAGAAGG - Intergenic
1117112963 14:52477448-52477470 TCACATAAACTTAAGGTAAAGGG + Intronic
1117240911 14:53831473-53831495 TCACATAAACTCAAGGTAAAGGG + Intergenic
1117271558 14:54148847-54148869 TCACATAAACTTAAGGTAAAAGG + Intergenic
1117634543 14:57728248-57728270 ACACACAGACTGAAAATAAAGGG - Intronic
1117655229 14:57949394-57949416 TCCCATAAACTTAAGGTAAAGGG - Intronic
1118128395 14:62935470-62935492 TCAGACAGACTGGAGGAAAAAGG + Intronic
1118165782 14:63334409-63334431 TCACATAAACTTAAGGTAAAGGG + Intergenic
1118281096 14:64429215-64429237 TCTCACAGGCTGGAGGGTAATGG - Intronic
1118994640 14:70824569-70824591 CCTCAAAGACTGATGGTCAAGGG - Intergenic
1119405369 14:74395421-74395443 TCCCACAGCCTGCAGGTAGAGGG - Intergenic
1119499365 14:75110590-75110612 TCTCAGAGACAGAAAGCAAATGG - Intronic
1120396060 14:83968614-83968636 TGTTACGCACTGAAGGTAAATGG - Intergenic
1120450738 14:84664091-84664113 TCACATAAACTTAAGGTAAACGG - Intergenic
1120677090 14:87433279-87433301 AGTCACAGACTGAAGGTTAATGG + Intergenic
1121130620 14:91442803-91442825 ACACACAGACTGAAAATAAAGGG + Intergenic
1121278954 14:92686535-92686557 TCCCACAGACTGTAGGGACATGG + Intronic
1121475839 14:94201683-94201705 TCACATAAACTTAAGGTAAAGGG - Intronic
1122828100 14:104381957-104381979 TCTTAAAGAGTGAAGGTGAAAGG + Intergenic
1123951075 15:25276007-25276029 TCTAAAAGACTGAAAATAAAGGG - Intergenic
1124505311 15:30267491-30267513 TCACATAAACTTAAGGTAAAGGG + Intergenic
1124738241 15:32271140-32271162 TCACATAAACTTAAGGTAAAGGG - Intergenic
1124793099 15:32748813-32748835 TCCCATTGACAGAAGGTAAATGG + Intergenic
1125145645 15:36464911-36464933 TCTTATAAACTCAAGGTAAAGGG - Intergenic
1126440848 15:48686480-48686502 ACACACAGACTGAAAATAAAGGG + Intergenic
1126504722 15:49391513-49391535 TCACACAGACTTCAGATAAAGGG + Intronic
1126521241 15:49596747-49596769 TCACATAAACTTAAGGTAAAGGG + Intronic
1126654372 15:50959903-50959925 ACACACAGACTGAAAGTGAAGGG + Intronic
1126667680 15:51089939-51089961 ACTGACAGATTGAAGATAAATGG - Intronic
1127036304 15:54921987-54922009 TCGCATAAACTTAAGGTAAAGGG - Intergenic
1127036547 15:54924684-54924706 ACACACAGACTGAAAGTGAAGGG - Intergenic
1127188177 15:56502276-56502298 ACACATAGACTGAAAGTAAAGGG + Intergenic
1127191831 15:56539468-56539490 TCTCAGAGACTGAGGCTAAGAGG - Intergenic
1127694476 15:61431625-61431647 TCACATAAACTTAAGGTAAAGGG - Intergenic
1129091376 15:73154714-73154736 ACACATAGACTGAAAGTAAAAGG - Intronic
1129434335 15:75525883-75525905 TCTCCCAGACTGAAGTGAAGTGG - Intronic
1129500058 15:76027203-76027225 TCACATAGACTGAAAGTGAAGGG + Intronic
1129561996 15:76579797-76579819 ACACACAGACTGAAAATAAAGGG + Intronic
1129562644 15:76588460-76588482 TCACATAAACTTAAGGTAAAGGG - Intronic
1131658515 15:94487390-94487412 ACATACAGACTGAAAGTAAAGGG + Intergenic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1132007917 15:98247499-98247521 ACTCACAGGCTCAAGGTAAAGGG - Intergenic
1132253910 15:100357386-100357408 TCACATAAACTTAAGGTAAAAGG + Intergenic
1132269780 15:100513452-100513474 TATCACAGACTGAGGGGAAGAGG - Intronic
1132410370 15:101573407-101573429 TTTCAGAGACTGAAGGAAAATGG + Intergenic
1133375288 16:5281789-5281811 ACACACAGACTGAAAGTGAAGGG - Intergenic
1134515801 16:14885931-14885953 AGTCACAGACTGAAGGTTATGGG - Intronic
1134703472 16:16284575-16284597 AGTCACAGACTGAAGGTTATGGG - Intronic
1134964071 16:18427539-18427561 AGTCACAGACTGAAGGTTATGGG + Intronic
1134968358 16:18510075-18510097 AGTCACAGACTGAAGGTTATGGG + Intronic
1137418572 16:48310164-48310186 ACACACAGACTGAAGGTAAAGGG - Intronic
1137451598 16:48579739-48579761 TCACACAGACTGAAGGTGAAGGG + Intronic
1138192313 16:55024083-55024105 TCACATAAACTTAAGGTAAAGGG + Intergenic
1138262883 16:55638056-55638078 TTTCAAAGTCTGAAGGTAACAGG + Intergenic
1138864887 16:60805367-60805389 ACACACAGACTGAAAATAAAGGG + Intergenic
1139356472 16:66369768-66369790 TCCCACTGAATGAAGGTAGAGGG - Intronic
1140066770 16:71617893-71617915 TCTCCCAGTCTGGAGGGAAATGG + Intergenic
1140417444 16:74786108-74786130 CCTCACAATCAGAAGGTAAAAGG + Intergenic
1140531009 16:75666057-75666079 TCACATAAACTTAAGGTAAAGGG + Intronic
1140548113 16:75832014-75832036 TCACATAAACTTAAGGTAAAGGG - Intergenic
1140997372 16:80274281-80274303 ACTCACATACTGAAGCAAAAGGG + Intergenic
1141519785 16:84571152-84571174 TCAGCCAGACTGAAGGTGAAGGG - Intronic
1141569866 16:84928049-84928071 CCTCACAGCCTGAAGGTCAATGG - Intergenic
1142050908 16:87957563-87957585 TCTCAGACACAGAAGGTAACTGG - Intronic
1144292782 17:13842492-13842514 TCTCACAGACTGGAGTAAAGTGG - Intergenic
1148196589 17:45717971-45717993 TCCCACAGATTAAATGTAAAAGG - Intergenic
1150000664 17:61436457-61436479 ACACACAGGCTGAAAGTAAAGGG - Intergenic
1150524397 17:65906944-65906966 TGTAACACACTGAAGGGAAATGG + Intronic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1150896087 17:69212814-69212836 TCACATAAACTTAAGGTAAAGGG - Intronic
1151079010 17:71306716-71306738 TCACATAAACTTAAGGTAAAGGG + Intergenic
1153071736 18:1114063-1114085 TCACACAAACTTAAGGTAAAGGG - Intergenic
1153091699 18:1353941-1353963 TCTCCCATACTGAATGGAAATGG - Intergenic
1153425241 18:4955661-4955683 TCACATAAACTTAAGGTAAAGGG + Intergenic
1153532793 18:6066723-6066745 TCACATAAACTTAAGGTAAAGGG - Intronic
1153769736 18:8405662-8405684 TCCCACAGACTGAAAGTCAAAGG + Intronic
1154061699 18:11067516-11067538 ACACAGAGACTGAAGGTGAAAGG + Intronic
1154090198 18:11351351-11351373 TCACATAAACTTAAGGTAAAGGG + Intergenic
1155119710 18:22805896-22805918 TCTCCCAGACCGTAGGTAAGTGG + Intronic
1155192230 18:23440357-23440379 TCCCACAGGCAGAAAGTAAAGGG - Intergenic
1156410147 18:36820219-36820241 TTTTACTTACTGAAGGTAAAGGG - Intronic
1156773175 18:40755040-40755062 TCCTATAAACTGAAGGTAAAAGG - Intergenic
1156893170 18:42213620-42213642 TCACATAAACTTAAGGTAAAGGG - Intergenic
1156922372 18:42537809-42537831 TCCCACATAATGAATGTAAAAGG - Intergenic
1156986544 18:43356995-43357017 TCACAAAGATAGAAGGTAAATGG - Intergenic
1157022047 18:43795320-43795342 ACTGAAAGACTAAAGGTAAAAGG + Intergenic
1157218790 18:45809013-45809035 TCACATAAACTTAAGGTAAAGGG + Intergenic
1157427046 18:47593066-47593088 TCTACCAGAAGGAAGGTAAATGG - Intergenic
1157507699 18:48240974-48240996 TCACATAGACTTAAGGTTAAGGG + Intronic
1157628371 18:49071379-49071401 TTACACAGACTGAAGTTAAGTGG - Intronic
1158431586 18:57392523-57392545 TCTCATAGACTGAAAATAAAGGG + Intergenic
1158788457 18:60744673-60744695 TTCCACACACTGAAAGTAAATGG + Intergenic
1159322284 18:66867329-66867351 TCCCAGAGACTGAAGAAAAAAGG - Intergenic
1159612677 18:70544154-70544176 TCACAAAAACTTAAGGTAAAGGG - Intergenic
1159906793 18:74099690-74099712 TCACATAAACTTAAGGTAAAGGG + Intronic
1160059028 18:75512952-75512974 TCACATAAACTTAAGGTAAAGGG + Intergenic
1162666471 19:12217448-12217470 ACACACAGACTGAAAATAAAGGG - Intergenic
1163199645 19:15756897-15756919 TCTTAAAGACTCATGGTAAAGGG - Intergenic
1165017611 19:32893169-32893191 CCATACAGACTGAAAGTAAAGGG + Intronic
1165387236 19:35517760-35517782 TCGCTCAGGCTGAAGGTCAATGG + Intergenic
1165810928 19:38611249-38611271 CCTCCCCGACTGAAGGAAAAAGG - Exonic
1166262930 19:41654683-41654705 TCACATAAACTTAAGGTAAAGGG + Intronic
1166450301 19:42893560-42893582 TCACATAAACTTAAGGTAAAAGG - Intronic
1166899875 19:46051760-46051782 TCACATAAACTTAAGGTAAATGG + Intronic
1167270744 19:48504299-48504321 TCCCACAGCGTGAGGGTAAAGGG - Intronic
1167401089 19:49270076-49270098 ACACACAGACTGAAAGTGAAGGG + Intergenic
925127264 2:1468053-1468075 TCACATAAACTTAAGGTAAAGGG - Intronic
925637714 2:5957615-5957637 TCTTATACACTTAAGGTAAAGGG - Intergenic
926990423 2:18674157-18674179 TCTTATAGACTTCAGGTAAAGGG - Intergenic
927036525 2:19183321-19183343 TCACATAAACTTAAGGTAAAGGG - Intergenic
927363298 2:22262967-22262989 TCACATAAACTTAAGGTAAAAGG - Intergenic
927738878 2:25548810-25548832 TAGAACAGACTGAAGGGAAAAGG + Intronic
928356893 2:30624393-30624415 TCACATAAACTTAAGGTAAAGGG + Intronic
928361999 2:30671069-30671091 TTTCCCTGGCTGAAGGTAAAAGG - Intergenic
928685193 2:33742545-33742567 TCACATATACTTAAGGTAAAGGG - Intergenic
928740010 2:34340479-34340501 ACACACAGACTGAAAGTGAAAGG + Intergenic
928798670 2:35058473-35058495 TCACATAAACTTAAGGTAAAGGG - Intergenic
928799504 2:35069773-35069795 ACCCACAGGCTGAAAGTAAAGGG + Intergenic
928988665 2:37206927-37206949 TCACATAAACTTAAGGTAAAGGG + Intronic
930145651 2:48000932-48000954 TCTTACAGGCTCAAGGTAAATGG + Intergenic
930212131 2:48652146-48652168 CCTCACTGATTGAAGGAAAATGG + Intronic
930423271 2:51179844-51179866 TCACATAAACTTAAGGTAAAAGG + Intergenic
930527523 2:52548505-52548527 TCACACAGATTGAAAATAAATGG - Intergenic
931136178 2:59403925-59403947 TCACACAAACTTAAGGTAAAGGG + Intergenic
931136808 2:59412377-59412399 TCACACAAATTTAAGGTAAATGG - Intergenic
931534917 2:63264248-63264270 ACACACAGACTGAAAGTAAATGG + Intronic
931568774 2:63645867-63645889 ACACATAGACTGAATGTAAAGGG - Intronic
932867987 2:75366934-75366956 TCCCATAGGCTGAAAGTAAAGGG - Intergenic
932933436 2:76072263-76072285 ACACAGAGACTGAAAGTAAAGGG + Intergenic
933073489 2:77892056-77892078 TCTCTCAGAGTGACTGTAAAAGG - Intergenic
933086127 2:78056582-78056604 TCACATAAACTTAAGGTAAAAGG - Intergenic
933137519 2:78756941-78756963 CCTCCCAGACAAAAGGTAAAAGG + Intergenic
933403714 2:81831061-81831083 ACTTACAGACTGAAGGTGAAGGG + Intergenic
933627360 2:84616555-84616577 TCACATAAACTTAAGGTAAAGGG - Intronic
935393278 2:102577648-102577670 ACACACAGACTGAAAATAAAGGG - Intergenic
935610255 2:105015659-105015681 TCACATAAACTTAAGGTAAAGGG - Intergenic
935929854 2:108112838-108112860 CCTCAAAGATTGAAGGTAGATGG - Intergenic
936555105 2:113489638-113489660 TCACATAAACTTAAGGTAAAGGG + Intronic
936900000 2:117472158-117472180 TCTTATAAACTCAAGGTAAAGGG - Intergenic
936910959 2:117593193-117593215 TCACATAAACTTAAGGTAAAGGG - Intergenic
937560824 2:123221907-123221929 ACACACAGACTGAAAATAAAGGG + Intergenic
937663212 2:124454175-124454197 TCACATAAACTTAAGGTAAAGGG + Intronic
937716139 2:125035681-125035703 TCACAAAAACTTAAGGTAAAGGG - Intergenic
937730086 2:125219951-125219973 ACACATAGACTGAAAGTAAAGGG - Intergenic
938175395 2:129122206-129122228 TCACATAAACTTAAGGTAAAGGG - Intergenic
938175565 2:129124145-129124167 TCTTATAGACTCAAGGTAAAGGG - Intergenic
938538783 2:132268380-132268402 ACTCACTAAATGAAGGTAAAGGG + Intergenic
938674742 2:133620396-133620418 TCACATACACTTAAGGTAAAGGG + Intergenic
939085407 2:137712705-137712727 ACTCACAGATTGAAAGTGAAGGG + Intergenic
939371503 2:141307473-141307495 TTATACAGACTGAAAGTAAACGG - Intronic
940099717 2:150020715-150020737 TCTCACATGCTGGAGCTAAAGGG - Intergenic
940131211 2:150385027-150385049 TCTTAAAGACTCAAGATAAAGGG - Intergenic
940503499 2:154524632-154524654 ACACACAGACTGAAAATAAAGGG - Intergenic
940630513 2:156231984-156232006 TCACATAAACTTAAGGTAAAGGG + Intergenic
940796618 2:158087354-158087376 TCACATAAACTTAAGGTAAAGGG - Intronic
940829433 2:158452056-158452078 TCTCAGACATTGAAGGTAAGAGG - Intronic
940865981 2:158818126-158818148 TCTCTCAGACCAAAGGGAAATGG + Intronic
941060862 2:160845023-160845045 TCACATAAACTTAAGGTAAAGGG + Intergenic
941260642 2:163292511-163292533 TAACACAGACTTAAGGTAGAAGG + Intergenic
941358173 2:164517640-164517662 TCACATAAACTTAAGGTAAAGGG + Intronic
941411115 2:165158246-165158268 TCTGTAAGACTAAAGGTAAAAGG - Intronic
941674704 2:168331260-168331282 ACATACAGACTGAAAGTAAAGGG + Intergenic
941999226 2:171629469-171629491 TCTGACAGACTGAGACTAAATGG - Intergenic
942750464 2:179280730-179280752 ACACACAGACTGAAAATAAAGGG + Intergenic
942868397 2:180704773-180704795 TCTCATAGTCTGAAAGTGAAGGG - Intergenic
943075262 2:183186919-183186941 TCACAAAGACTGAAAGTAAAGGG - Intergenic
943149736 2:184097286-184097308 TCACATAAACTTAAGGTAAAGGG - Intergenic
943446975 2:187998328-187998350 TTTTATAGACTCAAGGTAAAGGG + Intergenic
943957033 2:194205753-194205775 ACCCACAGACTCAAGATAAAGGG - Intergenic
944259902 2:197665632-197665654 ACATACAGACTGAAAGTAAAGGG - Intronic
945337974 2:208615570-208615592 TCACATAAACTTAAGGTAAAGGG - Intronic
945354591 2:208824310-208824332 TGTCACAGTCTGCAGCTAAAAGG + Intronic
945536361 2:211023230-211023252 TCACAAAAACTTAAGGTAAAGGG - Intergenic
945573931 2:211506058-211506080 CCTAACAGACTTAAAGTAAAGGG + Intronic
945861469 2:215127659-215127681 TCACACAAACTTAAAGTAAAGGG - Intronic
946501492 2:220252016-220252038 TCACATAAACTGAAAGTAAAGGG + Intergenic
946610925 2:221456864-221456886 ACTCAGAAACTGAAAGTAAATGG + Intronic
946874740 2:224116219-224116241 TCTTATAGACTCAAGGTCAAGGG + Intergenic
947179060 2:227396160-227396182 TCTCAAGGACTGAAGCAAAAGGG + Intergenic
947460694 2:230301906-230301928 TCACATAAACTTAAGGTAAAGGG + Intronic
947738344 2:232471512-232471534 ACTCATAGACTGAAAGTGAAAGG - Intergenic
948244898 2:236472680-236472702 TATGACAGATTGAAGGAAAATGG - Intronic
1169397719 20:5249187-5249209 TCACATAAACTTAAGGTAAAGGG - Intergenic
1169409647 20:5356785-5356807 TTTCTCAGAGTGAAGGTAAGTGG - Intergenic
1169453095 20:5728965-5728987 TCACCCAGACTGAAGTTCAATGG + Intergenic
1169693089 20:8355520-8355542 TCTCACAAATGGAAGGTTAATGG - Intronic
1170026647 20:11895798-11895820 GCTCAAAGACTGAGGGTAAAAGG - Intronic
1170086427 20:12537427-12537449 TCACATAAACTTAAGGTAAAGGG + Intergenic
1170241522 20:14172202-14172224 TCACATAAACTTAAGGTAAAAGG - Intronic
1170726722 20:18935323-18935345 TCACATAAACTTAAGGTAAAGGG - Intergenic
1170741244 20:19058705-19058727 TCACATAAACTTAAGGTAAAAGG + Intergenic
1171027982 20:21649798-21649820 TTGCACAAACTTAAGGTAAAGGG + Intergenic
1171066759 20:22024835-22024857 TCACATAAACTTAAGGTAAAGGG - Intergenic
1171080379 20:22176250-22176272 TCACATAAACTTAAGGTAAAGGG - Intergenic
1171378455 20:24713018-24713040 TCTCATAAACTTAAGGTAAAGGG - Intergenic
1172851233 20:37967295-37967317 TCACATAAACTTAAGGTAAAGGG - Intergenic
1173018191 20:39245685-39245707 TCTCACAGCCTGAGGGAAGAGGG + Intergenic
1173203968 20:40977339-40977361 ACACACAGACTGAAAATAAAGGG - Intergenic
1174840652 20:53898478-53898500 TCTCCCAGACTCAGGGCAAAGGG + Intergenic
1174995626 20:55564997-55565019 ACCCACAGACTCAAAGTAAAGGG - Intergenic
1175548308 20:59795830-59795852 ACACACAGACTGAAAGTGAAGGG - Intronic
1175617873 20:60418168-60418190 TCTTACAGCCTCAAGGTAAAGGG - Intergenic
1176694316 21:9956579-9956601 TCTCATAGATTCAAGGTAAGGGG - Intergenic
1176906283 21:14505372-14505394 TCACACAAACTTAAGGTACAGGG + Intronic
1177200341 21:17946764-17946786 ACACATAGACTGAAAGTAAAGGG - Intronic
1177494408 21:21871028-21871050 ACACACAGACTGAAAATAAAGGG - Intergenic
1177934950 21:27333556-27333578 TCACATAAACTTAAGGTAAAGGG + Intergenic
1177950992 21:27537072-27537094 TCTTACAGACTCAAGAGAAATGG + Intergenic
1177963459 21:27698186-27698208 GCTTACAGTGTGAAGGTAAAGGG + Intergenic
1178733060 21:35122582-35122604 TCACATAAACTTAAGGTAAAGGG + Intronic
1178741146 21:35202670-35202692 TCTAACATACTGAAGGCAAAGGG + Intronic
1178988449 21:37330437-37330459 TCTCCCAGGCTGGAGGGAAATGG - Intergenic
1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG + Intronic
1179313146 21:40214624-40214646 TCTTATAGACTACAGGTAAAGGG + Intronic
1179467573 21:41587289-41587311 TCACATAAACTTAAGGTAAAGGG - Intergenic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1180040073 21:45272184-45272206 TCACACAAACTTAAGGTAAAGGG + Intronic
1180191494 21:46166556-46166578 TCACACAGACTGAAAATAAAGGG + Intronic
1180314349 22:11265018-11265040 ACTCACTAAATGAAGGTAAAGGG + Intergenic
1180341009 22:11618533-11618555 ACTCACTAAATGAAGGTAAAGGG - Intergenic
1180860100 22:19073912-19073934 TCTCCCACACTGATGGTGAACGG + Intronic
1182206977 22:28637839-28637861 ACACACAGACTGAAAGTGAAGGG + Intronic
1183029037 22:35088150-35088172 TCCCACACACATAAGGTAAAGGG - Intergenic
1183910116 22:41072690-41072712 TCTCACACACTGAGAGTAGAGGG + Intergenic
1184063791 22:42103282-42103304 TCACATAAACTTAAGGTAAAGGG - Intergenic
1184625790 22:45727949-45727971 TCTTACAGAATCAAAGTAAAGGG - Intronic
949448249 3:4158846-4158868 ACACACAGACTGAAAATAAAGGG - Intronic
950599019 3:14015289-14015311 TCACATAAACTTAAGGTAAAGGG - Intronic
951404816 3:22282960-22282982 ACTCATAAACTTAAGGTAAAGGG + Intronic
951690823 3:25394765-25394787 TCACATAAACTTAAGGTAAAGGG - Intronic
951740712 3:25919899-25919921 ACTCACAGTCTCAATGTAAAGGG + Intergenic
952035267 3:29193404-29193426 ACACACAGACTGAAAGTGAAGGG - Intergenic
952066209 3:29574429-29574451 ACCCACAGACTGAAAATAAAGGG - Intronic
952083072 3:29783821-29783843 TCACATAAACTTAAGGTAAAGGG + Intronic
952228754 3:31407257-31407279 TGTCACAGACTGTAGGTCAGTGG - Intergenic
952435041 3:33265208-33265230 TCACATAAACTTAAGGTAAAGGG - Intergenic
952460945 3:33525629-33525651 TCTGACAGACTGAAGGCTAGTGG - Intronic
952678228 3:36059291-36059313 TCTATAAGACTGAAGGCAAAAGG + Intergenic
952689656 3:36190319-36190341 TCACACAAACTTAAGGTTAAGGG - Intergenic
952694815 3:36252224-36252246 TCACACAGGCTCAAAGTAAAAGG + Intergenic
952714726 3:36468954-36468976 TCACATAAACTTAAGGTAAAGGG - Intronic
952726045 3:36585661-36585683 ACACACAGACTGAAAATAAAGGG + Intergenic
953100939 3:39827021-39827043 ACCCATAGACTGAAAGTAAAGGG - Intronic
953495341 3:43381342-43381364 TCACATAAACTTAAGGTAAAGGG + Intronic
953560540 3:43987659-43987681 ACCCACAGACTGAAAGTGAAGGG - Intergenic
953639343 3:44691222-44691244 TCACATAAACTTAAGGTAAAGGG + Intergenic
953903287 3:46855191-46855213 TCATACAGACAGAAAGTAAATGG - Intergenic
954086215 3:48245905-48245927 TCACCCAGGCTGAAGGTCAATGG - Intronic
955342567 3:58136696-58136718 TCTTAGAAACTGAAGGAAAAAGG - Intronic
955393896 3:58541845-58541867 ACACACAGACTGAGAGTAAAGGG - Intergenic
955426548 3:58796728-58796750 TCTCACAAATTGAAGGTTTATGG + Intronic
955871740 3:63446102-63446124 TCCAAAAGACTGAAGGTCAAAGG - Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
957066769 3:75529393-75529415 ACACACAGACTGAAAGTGAAGGG + Intergenic
957433126 3:80139435-80139457 TCACATAAACTTAAGGTAAAGGG + Intergenic
957732630 3:84160664-84160686 TCTCACATAATGAATGTATAAGG - Intergenic
957907084 3:86570804-86570826 ATTTATAGACTGAAGGTAAAGGG + Intergenic
957971893 3:87392537-87392559 TCACATAAACTTAAGGTAAAGGG + Intergenic
958064357 3:88524181-88524203 TCACATAAACTTAAGGTAAAGGG - Intergenic
958262595 3:91399580-91399602 TCTTATAGGCTGAAGATAAATGG - Intergenic
958509917 3:95035080-95035102 TCACATAAACTTAAGGTAAAGGG - Intergenic
958695778 3:97526248-97526270 TCTCTCAGTCTGAAGACAAAAGG + Intronic
958770859 3:98423780-98423802 TCACATAAACTTAAGGTAAAGGG + Intergenic
958771476 3:98430775-98430797 GCACATAGATTGAAGGTAAAGGG + Intergenic
958787171 3:98610890-98610912 TCACATAAACTTAAGGTAAAGGG - Intergenic
958818845 3:98949633-98949655 TCACATAAACTTAAGGTAAAGGG - Intergenic
958827089 3:99043216-99043238 ACACATAGACTGAAAGTAAAGGG + Intergenic
958976757 3:100676957-100676979 ACACACAGACTGAAAATAAATGG - Intronic
959047164 3:101486892-101486914 TCACATAAACTTAAGGTAAAGGG + Intronic
959118260 3:102203578-102203600 ACACACAGACTGAAAATAAAGGG - Intronic
959424013 3:106163531-106163553 TCACATAAACTTAAGGTAAAGGG + Intergenic
959660197 3:108859863-108859885 TCCCACAGACTGGAGGATAAAGG - Intergenic
959715540 3:109429335-109429357 TCACATAAACTTAAGGTAAAAGG - Intergenic
959877995 3:111408790-111408812 TCACATAAACTTAAGGTAAAGGG + Intronic
959954910 3:112225698-112225720 GCCCACAGACTGAAAGTGAAGGG + Intronic
960012011 3:112843826-112843848 ACACACAGGCTGAAAGTAAAGGG + Intronic
960152877 3:114268997-114269019 TCACATAAACTTAAGGTAAAGGG - Intergenic
960542549 3:118877695-118877717 ACACACAGACTGAAAATAAAGGG + Intergenic
960578311 3:119248904-119248926 TCACATAAACTTAAGGTAAAGGG + Intergenic
960633655 3:119760160-119760182 TCACATAGACTGAAAGTGAAAGG + Intronic
960712145 3:120542157-120542179 TCACATAAACTTAAGGTAAAGGG - Intergenic
960782702 3:121337324-121337346 TCTTACAAACTCGAGGTAAAGGG + Intronic
960873479 3:122274228-122274250 GTTCACAGACTGCAGGTTAAGGG + Intronic
960966107 3:123105876-123105898 TCTGAGTGACTGAAGGGAAAGGG + Intronic
961286374 3:125808661-125808683 ACACACAGACTGAAAGTGAAGGG - Intergenic
962013106 3:131412645-131412667 TCACATAAACTTAAGGTAAAGGG + Intergenic
962034636 3:131638316-131638338 TCACATAAACTTAAGGTAAAGGG + Intronic
962382843 3:134911262-134911284 TCTCAGAGCCTGCAGGGAAATGG + Intronic
962503175 3:136016678-136016700 TCACAGAGACTTAAGGTAAAGGG - Intronic
962615257 3:137120144-137120166 ACTAATAGACTGAAGGTAAAGGG - Intergenic
962709622 3:138074927-138074949 TCACACAAACTTAAGGTAAAGGG + Intronic
963007958 3:140743799-140743821 CCATAGAGACTGAAGGTAAAGGG + Intergenic
963785922 3:149534360-149534382 TCTCACAGCCAGCAGGTGAAAGG - Intronic
963824349 3:149935241-149935263 ACACATAGACTGAAAGTAAAGGG - Intronic
964252945 3:154741158-154741180 TCACATAAACTTAAGGTAAAAGG + Intergenic
964342675 3:155724607-155724629 TCACATAAACTTAAGGTAAAGGG - Intronic
964644039 3:158938749-158938771 TCACATAAACTTAAGGTAAAGGG + Intergenic
964772830 3:160242138-160242160 TCACATAAACTTAAGGTAAAGGG + Intronic
964804314 3:160590224-160590246 ACACACAGACTGAAAATAAATGG + Intergenic
965009954 3:163074404-163074426 ACACACAGACTGAAAATAAAGGG + Intergenic
965154222 3:165026109-165026131 TCACACAAACTCAAGATAAAGGG + Intronic
965237079 3:166137573-166137595 TCTCACAGGCTGGAGGGCAATGG - Intergenic
965296429 3:166953361-166953383 TCACATAAACTTAAGGTAAAGGG - Intergenic
965345346 3:167541825-167541847 ACTCATAAACTTAAGGTAAAGGG + Intronic
965394527 3:168146081-168146103 ACTTACAGACTGAAGATAAAGGG - Intergenic
965874189 3:173297637-173297659 TCACACAAACTTAAGGTAAAGGG - Intergenic
966229725 3:177638931-177638953 TCACATAAACTTAAGGTAAAGGG - Intergenic
966553087 3:181227762-181227784 TCACATAAACTTAAGGTAAAAGG - Intergenic
967508680 3:190284633-190284655 ATACACAGACTGAAGGTAAAGGG - Intergenic
967651593 3:191992430-191992452 TCACATAAACTTAAGGTAAAGGG + Intergenic
968807276 4:2782818-2782840 TCACATAAACTTAAGGTAAAGGG - Intergenic
969011370 4:4065488-4065510 ACACACAGACTGAAAGTGAAGGG + Intergenic
969383875 4:6829621-6829643 TCCCACAGCCTGAAAGTGAATGG + Intronic
969742704 4:9044412-9044434 ACACACAGACTGAAAGTGAAGGG - Intergenic
969802078 4:9576521-9576543 ACACACAGACTGAAAGTGAAGGG - Intergenic
970081682 4:12294451-12294473 TCTTACATAATGAAGGGAAATGG - Intergenic
970208854 4:13685821-13685843 ACACACAGACTGAATGTAAAGGG - Intergenic
970215629 4:13757016-13757038 TCACATAAACTGCAGGTAAAAGG - Intergenic
970283154 4:14480406-14480428 TCCCATAAACTTAAGGTAAAGGG + Intergenic
970856423 4:20653702-20653724 TCACATAAACTTAAGGTAAAGGG + Intergenic
971096219 4:23407265-23407287 ACTCACAGGCTTAAAGTAAATGG - Intergenic
971417435 4:26445284-26445306 TATGATAGACTCAAGGTAAAGGG + Intergenic
971797469 4:31246553-31246575 ACACATAGACTGAAGGTAAAGGG + Intergenic
971914241 4:32847955-32847977 TTTCATAGACTGAAAATAAAGGG - Intergenic
972063817 4:34913485-34913507 ACACATAGACGGAAGGTAAAGGG + Intergenic
972097147 4:35362601-35362623 TCACATAAACTTAAGGTAAAAGG - Intergenic
972366316 4:38378369-38378391 TCTCACAGGGTGAAGAGAAAAGG + Intergenic
972909808 4:43800497-43800519 ACGCACAGACTGAAAATAAAGGG + Intergenic
973004591 4:44991759-44991781 TCTTGCAGACAGAAGGTACAAGG + Intergenic
973579578 4:52329262-52329284 ACTCACAGACTGAAAGTGAAGGG - Intergenic
973675855 4:53262117-53262139 TCACATAAACTTAAGGTAAAGGG - Intronic
973831314 4:54762684-54762706 TCCCACAAACTTAAGGTAAAGGG - Intergenic
974329984 4:60465620-60465642 ACCCACAGACTCAAAGTAAAAGG + Intergenic
974583283 4:63835307-63835329 TCACATAAACTTAAGGTAAAGGG - Intergenic
974612149 4:64230672-64230694 CCTCAGAGACTGAGGGTCAAAGG + Intergenic
975509969 4:75183169-75183191 TCACATAAACTTAAGGTAAAGGG + Intergenic
975623426 4:76317256-76317278 TCACATAAACTTAAGGTAAAGGG + Intronic
975944836 4:79693859-79693881 TCACATAAACTTAAGGTAAAGGG - Intergenic
976157221 4:82159282-82159304 TCACAAAAACTTAAGGTAAAGGG + Intergenic
976562589 4:86519486-86519508 TCACATAAACTTAAGGTAAAGGG - Intronic
976869762 4:89776752-89776774 TCACATAAACTTAAGGTAAAGGG + Intronic
977199314 4:94097112-94097134 ACACATAGACTGAAAGTAAAGGG - Intergenic
977424677 4:96852864-96852886 TCTGACAGACTGCAGTTGAAAGG + Intergenic
977489425 4:97693312-97693334 TCACATAAACTTAAGGTAAAAGG + Intronic
977521931 4:98095444-98095466 GCACAGAGACTGAAAGTAAAAGG + Intronic
977635718 4:99295584-99295606 TCACATAAACTTAAGGTAAAGGG + Intergenic
978305497 4:107323605-107323627 TCTGTCAGACTGAAGATTAAAGG + Intergenic
978306706 4:107336470-107336492 ACTTACAGACTCAAGGCAAAGGG - Intergenic
978316746 4:107446509-107446531 TCACTCAAACTTAAGGTAAAGGG - Intergenic
978343930 4:107746132-107746154 TCTATGAGACTAAAGGTAAAAGG + Intergenic
978762027 4:112363332-112363354 TCACATAAACTTAAGGTAAAGGG + Intronic
978925115 4:114233443-114233465 TCACATAAACTTAAGGTAAAGGG + Intergenic
978925917 4:114243945-114243967 AATCACAGACTCAAGGTAGAGGG - Intergenic
979020518 4:115491001-115491023 TCACATAAACTTAAGGTAAAGGG + Intergenic
979413682 4:120409409-120409431 ACACACAGACTGAAAATAAAGGG + Intergenic
979461733 4:120991505-120991527 TCACAGAAACTTAAGGTAAAGGG - Intergenic
979664043 4:123291176-123291198 TCTTATAGACTCAAGGTAAGGGG - Intronic
979712489 4:123796496-123796518 TCACATAAACTTAAGGTAAAGGG - Intergenic
979914874 4:126418980-126419002 ACTTATAGACTGAAGGTAAAGGG - Intergenic
979927512 4:126585666-126585688 ACTTACAGACTCAAGATAAAAGG + Intergenic
979984662 4:127298637-127298659 TCACATAAACTTAAGGTAAAGGG + Intergenic
980087597 4:128407753-128407775 TCACATAAACTTAAGGTAAAGGG - Intergenic
980366936 4:131816809-131816831 TCTCATAGACTCAAGGTAAGGGG - Intergenic
980454753 4:133024342-133024364 ACTCACAGGCTCAAAGTAAAAGG + Intergenic
980631457 4:135440751-135440773 ACTCATAGACTGAAAGCAAAGGG + Intergenic
980979331 4:139640840-139640862 TTTCACAGGCTGAATGGAAAGGG - Intergenic
981139355 4:141250862-141250884 TCTTACAGACTCAAGGCAAAGGG - Intergenic
981297813 4:143153371-143153393 ACACACAGACTGAAAATAAAGGG - Intergenic
981367113 4:143916250-143916272 TCACATAAACTTAAGGTAAAGGG + Intergenic
981376907 4:144026485-144026507 TCACATAAACTTAAGGTAAAGGG + Intergenic
981387410 4:144147835-144147857 TCACATAAACTTAAGGTAAAGGG + Intergenic
981460317 4:145006359-145006381 ACCCATAGTCTGAAGGTAAAGGG - Intronic
981629099 4:146797385-146797407 TCCTACACACTGAAGGAAAAGGG - Intronic
981647217 4:147013084-147013106 ACCCAGAGACTAAAGGTAAAAGG + Intergenic
982050068 4:151491768-151491790 TCACATAAACTTAAGGTAAAGGG + Intronic
982119412 4:152127206-152127228 TCTCACAAACTTAAGGTAAAGGG - Intergenic
982188020 4:152822185-152822207 TCTTACAGACTCAAGGTAGAGGG + Intronic
982299333 4:153863274-153863296 TCACATAAACTTAAGGTAAAGGG - Intergenic
982487156 4:155979767-155979789 TCCCACAGACTTAAGGTAAAGGG - Intergenic
982491953 4:156040504-156040526 TCACAGAAACTTAAGGTAAAGGG + Intergenic
982829944 4:160046447-160046469 TCTCATAAACTTAAGGTAAAGGG + Intergenic
983036036 4:162866936-162866958 TCACATAAACTTAAGGTAAAGGG + Intergenic
983050498 4:163040525-163040547 ATTCACAGACTGAAAATAAAGGG + Intergenic
983579831 4:169297309-169297331 ACTCAAAGACTGAAAATAAAGGG + Intergenic
983669583 4:170220148-170220170 TCTTACAGACTGAAAGGGAAGGG + Intergenic
983807639 4:172015411-172015433 TCATACAAACTTAAGGTAAAGGG - Intronic
983954651 4:173683012-173683034 TATCACAGAGTGAATGTTAACGG + Intergenic
984171575 4:176366368-176366390 ACTCACAGGCTCAAAGTAAAGGG - Intergenic
984273824 4:177583246-177583268 GCTCACTGACAGAATGTAAAGGG + Intergenic
984474937 4:180224077-180224099 TCACATAAACTTAAGGTAAAGGG - Intergenic
984691035 4:182726307-182726329 TCAAACAGACTTAAGGAAAAAGG + Intronic
985355939 4:189118933-189118955 TCACATAAACTTAAGGTAAATGG + Intergenic
986262397 5:6159906-6159928 TGTCACAGACTGAAGACAATGGG - Intergenic
986634227 5:9804015-9804037 TCACATAAACTTAAGGTAAAGGG + Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
986782659 5:11081159-11081181 TATGAGAGACTGAAGGTAAGAGG + Intronic
986857624 5:11889120-11889142 TCTTACAGAAAGAAGGAAAAGGG - Intronic
987021815 5:13880961-13880983 ACTCACAGATTGAAAGTGAAGGG + Intronic
987272048 5:16320360-16320382 TCTCATAGACTGCTGCTAAAAGG - Intergenic
988278256 5:29111694-29111716 TCACATAAACTTAAGGTAAAGGG - Intergenic
988421011 5:31006262-31006284 TCACATAAACTTAAGGTAAAGGG - Intergenic
988876095 5:35447622-35447644 TCTCCCAGACTGAAGTTCAGTGG + Intergenic
988990977 5:36670857-36670879 TCTCACAAGGTGAAGGGAAAAGG - Intronic
989027311 5:37082712-37082734 ACACACAGACTGAAAGTGAAGGG + Intergenic
989033611 5:37145921-37145943 TCAAACAGCCTGAAAGTAAAGGG + Intronic
989074578 5:37550603-37550625 ACACACAGACTGAAAATAAAGGG - Intronic
989323940 5:40167807-40167829 ACCCATAGGCTGAAGGTAAAGGG + Intergenic
989355288 5:40537514-40537536 TCACATAAACTTAAGGTAAAGGG - Intergenic
989495373 5:42105679-42105701 TCTTACAGGTTAAAGGTAAAGGG - Intergenic
989694179 5:44180514-44180536 TCACATAAACTTAAGGTAAAGGG - Intergenic
990572965 5:57097200-57097222 TCACACAAACTTAACGTAAAGGG + Intergenic
990853996 5:60242110-60242132 ACACACAGACTGAAACTAAAAGG + Intronic
990899543 5:60735728-60735750 TCACATAAACTTAAGGTAAAGGG - Intergenic
990906620 5:60810341-60810363 AATCACATACTGAAGGGAAAGGG + Intronic
991414932 5:66382306-66382328 TCACATAAACTTAAGGTAAAGGG + Intergenic
991543357 5:67753925-67753947 TCACATAAACTTAAGGTAAAGGG + Intergenic
992339892 5:75812726-75812748 TCACATAAACTTAAGGTAAAGGG - Intergenic
992520353 5:77544443-77544465 TCACACAAACTTAAGGTAAAGGG + Intronic
992799557 5:80283582-80283604 ACACACAGACTGAAAGTGAAGGG - Intergenic
993743474 5:91566803-91566825 TCACATGAACTGAAGGTAAAGGG + Intergenic
993779529 5:92049327-92049349 ACTCAAAGACTCAATGTAAAGGG - Intergenic
993936930 5:94016062-94016084 ACACACAGACTGAAAGTGAAGGG + Intronic
994002363 5:94795138-94795160 TCTCAGAGAATGAAGGAAATAGG - Intronic
994028956 5:95118656-95118678 ATACACAGACTGAAAGTAAAGGG + Intronic
994309836 5:98256693-98256715 ACACACAGACTGAAAATAAAGGG - Intergenic
994358168 5:98818592-98818614 TCACATAAACTTAAGGTAAATGG + Intergenic
994398900 5:99254700-99254722 TCACATAAACTTAAGGTAAAAGG - Intergenic
994645900 5:102468697-102468719 TCACACAAACTTAAAGTAAAAGG - Intronic
994777971 5:104059644-104059666 TCACATACACTTAAGGTAAAGGG - Intergenic
995587735 5:113665820-113665842 TCACATAAACTTAAGGTAAAGGG + Intergenic
995694397 5:114863933-114863955 TCACATAAACTTAAGGTAAAGGG - Intergenic
995722711 5:115153162-115153184 TCACAAAAACTTAAGGTAAAGGG + Intronic
995818020 5:116193450-116193472 TCACATAAACTGAAAGTAAAGGG + Intronic
996066779 5:119088313-119088335 ATACACAGACTGAAAGTAAAGGG - Intronic
996141130 5:119911139-119911161 TCACATAAACTTAAGGTAAAGGG - Intergenic
996197992 5:120633496-120633518 TCACATAAACTTAAGGTAAAGGG + Intronic
996279625 5:121712942-121712964 TCACATAAACTTAAGGTAAAGGG + Intergenic
996326809 5:122284650-122284672 TCACATAAACTTAAGGTAAAAGG - Intergenic
996439456 5:123473169-123473191 TCACAAAGACTGAAAGTAAATGG - Intergenic
996531519 5:124532529-124532551 TCACACTGACTTAAGGCAAAAGG + Intergenic
996608817 5:125355659-125355681 TCACATAGACTTAAGGTAAAGGG - Intergenic
996657289 5:125956204-125956226 TCACATAAACTCAAGGTAAAGGG + Intergenic
996659631 5:125986284-125986306 ACACACAGACTGAAAATAAAGGG - Intergenic
996678532 5:126204113-126204135 TCACATAAACTTAAGGTAAAGGG + Intergenic
996780059 5:127175670-127175692 TCACATAAACTTAAGGTAAAGGG - Intergenic
996835203 5:127783999-127784021 TCTCATAAACTTAAGGTAAAGGG - Intergenic
996952262 5:129141403-129141425 TCTCAAAGTCTGAAAGTACATGG - Intergenic
997188332 5:131903911-131903933 ACTCACACACTCAAAGTAAAGGG + Intronic
997247240 5:132360325-132360347 TCTGAAAGACTGAGGGGAAAAGG + Intergenic
997798152 5:136832283-136832305 TCACATAAACTTAAGGTAAAGGG - Intergenic
999002232 5:147936909-147936931 ACACACAGACTGAAAATAAAGGG - Intergenic
999066278 5:148689246-148689268 ATTCACAGACTCAAAGTAAAAGG + Intergenic
999086299 5:148893673-148893695 TCACATAAACTTAAGGTAAAGGG + Intergenic
999108865 5:149097764-149097786 TCACATAAACTTAAGGTAAAGGG + Intergenic
999490945 5:152051230-152051252 TCACATAAACTTAAGGTAAAGGG - Intergenic
1000237863 5:159379416-159379438 TCACATAAACTTAAGGTAAAGGG + Intergenic
1000264680 5:159623591-159623613 TCACACAAACTTAAGATAAAGGG + Intergenic
1000511419 5:162188366-162188388 TCACATAAACTTAAGGTAAAGGG - Intergenic
1000584624 5:163081692-163081714 TCGCATAAACTTAAGGTAAAGGG + Intergenic
1000721737 5:164716869-164716891 TCTCACAGACTGGAGTGCAATGG + Intergenic
1000863608 5:166486066-166486088 TTTTACAAACTGAAGATAAAAGG - Intergenic
1001166874 5:169376654-169376676 TCACATAAACTTAAGGTAAAGGG + Intergenic
1001176968 5:169479181-169479203 TCACATAAACTTAAGGTAAAGGG - Intergenic
1001240486 5:170065898-170065920 ACTCATAGACTGAAAGTGAAGGG + Intronic
1001253098 5:170163670-170163692 TCCCACAGAATGAAGTGAAAAGG + Intergenic
1002207704 5:177575012-177575034 TCTAACAGGCTGAAGGTCAAGGG - Intergenic
1002893064 6:1353880-1353902 TCACATAAACTTAAGGTAAAGGG + Intergenic
1003028003 6:2575988-2576010 ACTCACAGTCTGAATGAAAAAGG - Intergenic
1003297276 6:4842632-4842654 TCACATAAACTTAAGGTAAACGG - Intronic
1003532148 6:6946664-6946686 TCTCTCAGACTGAAGGGGGAGGG - Intergenic
1004046142 6:12025720-12025742 TCTTCCACACTGCAGGTAAAGGG + Intronic
1004437891 6:15614557-15614579 TCTCAGAGAAGGAAGGTACAGGG - Intronic
1005305542 6:24510669-24510691 TCACAGAAACTTAAGGTAAAGGG - Intronic
1005673632 6:28132267-28132289 TCAGAAAGACTAAAGGTAAAAGG - Intergenic
1005691337 6:28309594-28309616 TCACATAAACTTAAGGTAAAGGG - Intergenic
1005692882 6:28324028-28324050 GCTCACAGGGTGAAGGGAAAGGG - Intergenic
1005793703 6:29334053-29334075 ACTGATAGACTCAAGGTAAAGGG + Intergenic
1006062781 6:31437586-31437608 TCACATAAACTGAAGGTAAAGGG - Intergenic
1007080017 6:39093575-39093597 TGTCAAAGACTGGAGCTAAAGGG - Intergenic
1007885948 6:45230571-45230593 ACATACAGACTGAAAGTAAAGGG - Intronic
1008089478 6:47279017-47279039 CTTCACAGTCTGAAGGAAAAAGG + Intronic
1008190478 6:48450618-48450640 TCACATAAACTTAAGGTAAAGGG - Intergenic
1008707357 6:54179265-54179287 ACTCACAGAGTGAAAATAAAGGG - Intronic
1008751836 6:54744106-54744128 ACACACAGACTGAAAGTAAAGGG - Intergenic
1008775219 6:55030233-55030255 TCCCATAAACTTAAGGTAAAGGG - Intergenic
1008992820 6:57623299-57623321 TCTTATAGGCTGAAGATAAATGG + Intronic
1009181441 6:60522417-60522439 TCTTATAGGCTGAAGATAAATGG + Intergenic
1009282223 6:61767322-61767344 ACACACAGACTGAAAATAAAGGG - Intronic
1009360104 6:62801054-62801076 TCACATAAACTTAAGGTAAAGGG - Intergenic
1009748348 6:67849300-67849322 ACACATAGACTGAAGATAAATGG + Intergenic
1009800061 6:68525992-68526014 TCACATAAACTTAAGGTAAAGGG - Intergenic
1010045498 6:71438169-71438191 TCACATAAACTTAAGGTAAAGGG + Intergenic
1010054960 6:71554759-71554781 TCACATAAACTTAAGGTAAAGGG - Intergenic
1010061910 6:71633073-71633095 ACACACAGACTGAAACTAAAGGG - Intergenic
1010456885 6:76066338-76066360 ACTCATAGACTGAAGCTAAAGGG + Intronic
1010801689 6:80184307-80184329 TCACATAAACTTAAGGTAAAGGG - Intronic
1010817301 6:80373871-80373893 TCACATAAACTTAAGGTAAAGGG - Intergenic
1010839875 6:80636285-80636307 ACTCATAGACTCAAAGTAAAGGG + Intergenic
1010862863 6:80935624-80935646 TCACATAAACTTAAGGTAAAAGG - Intergenic
1011093309 6:83631700-83631722 TCACACAAACTTAAGGTAAAGGG - Intronic
1011394816 6:86895132-86895154 TCACAGAAACTTAAGGTAAAGGG + Intergenic
1011587110 6:88938395-88938417 ACACATAGACTGAAAGTAAAGGG - Intronic
1011589150 6:88954260-88954282 TCACATAAACTTAAGGTAAAGGG + Intronic
1011620182 6:89235291-89235313 TCACATAAACTTAAGGTAAAGGG - Intergenic
1011933660 6:92746046-92746068 TCTTACAGAAAGAAGGAAAATGG - Intergenic
1012056765 6:94422435-94422457 TCTGAGAGACTGAAAGTAAAGGG - Intergenic
1012180501 6:96146637-96146659 TGTCACAGAAAGAAGGCAAAGGG + Intronic
1012208171 6:96487599-96487621 TCACATAAACTTAAGGTAAAGGG - Intergenic
1012212650 6:96541037-96541059 TCTCCCAGACTGTAAGTAACTGG + Intronic
1012521455 6:100126322-100126344 GCTTACAGCCTGAAGGTAAAAGG + Intergenic
1012536598 6:100305814-100305836 CCCCACAGACTGAAGGTCATAGG + Intergenic
1012965840 6:105671693-105671715 TCACATAAACTTAAGGTAAAGGG + Intergenic
1013571608 6:111432338-111432360 ACACACAGACTGAAAGTGAAAGG + Intronic
1013590389 6:111614993-111615015 TCACACAGACAGAAAGTAAACGG + Intergenic
1013686251 6:112587450-112587472 TCACATAAACTTAAGGTAAAGGG - Intergenic
1013727360 6:113115335-113115357 ACCCACAGACTCAAAGTAAAGGG + Intergenic
1013900157 6:115145894-115145916 TCTCACACACGGAATGTAACAGG - Intergenic
1013946246 6:115726435-115726457 TCACATAAACTTAAGGTAAAGGG - Intergenic
1013985347 6:116185731-116185753 TCACACAAACTAAAGGTAAAGGG - Intronic
1014022603 6:116608306-116608328 ACTCACAGGCTCAAGGTAAAGGG + Intergenic
1014086456 6:117351410-117351432 TCCCACAGAGAGAAGGGAAAAGG - Intronic
1014118683 6:117697431-117697453 ACACACAGACTGAAAATAAAGGG + Intronic
1014227990 6:118869777-118869799 ACTCTCAGACTGAAAGTGAAGGG + Intronic
1014235182 6:118946292-118946314 TCACATAAACTTAAGGTAAAGGG + Intergenic
1014284894 6:119486242-119486264 TCACAGAGACAGAAGGTAGAAGG + Intergenic
1014563186 6:122915321-122915343 ACTCACAGGCTGAAAGTTAAGGG - Intergenic
1014581572 6:123143867-123143889 TCACATAAACTTAAGGTAAAGGG + Intergenic
1014658441 6:124135400-124135422 TCACATAAACTTAAGGTAAAGGG + Intronic
1014902142 6:126979682-126979704 TCTCACAGAAAGATGGGAAAAGG - Intergenic
1015063582 6:128997877-128997899 TTTCTCAGACAGAAGATAAAAGG + Intronic
1015595268 6:134860487-134860509 TAGCACAGACTGAAGGTTACAGG + Intergenic
1015624954 6:135171418-135171440 TGTAACAGTGTGAAGGTAAAAGG + Intergenic
1016018113 6:139206772-139206794 TCACATAGACTTAAGGTAAAGGG + Intergenic
1016351555 6:143174565-143174587 TCACATAAACTTAAGGTAAAGGG - Intronic
1016909934 6:149188649-149188671 TCACATAAACTTAAGGTAAAAGG - Intergenic
1017161635 6:151371109-151371131 TCTGACACACTGGAGTTAAAGGG + Intronic
1017556114 6:155571148-155571170 TCACATAAACTTAAGGTAAAGGG - Intergenic
1017568613 6:155716040-155716062 GCTCACAAACTGAAGGTATTGGG - Intergenic
1017684243 6:156896109-156896131 ACTCTAAGACAGAAGGTAAATGG - Intronic
1017933931 6:158987328-158987350 ACACATAGACTGAAAGTAAAGGG - Intronic
1018110135 6:160528646-160528668 TCAAACAGACTGAAAGTAAAGGG - Intergenic
1018489907 6:164280993-164281015 TCTCCCAGGCTGAAGTTCAATGG - Intergenic
1019090071 6:169522108-169522130 ACACACAGACTGAAAGTGAAGGG + Intronic
1019122902 6:169818754-169818776 TCACATAAACTTAAGGTAAATGG - Intergenic
1020450123 7:8312180-8312202 TCTTACAGACTCAAGGTAAAGGG - Intergenic
1021587120 7:22221331-22221353 CCTCACAGATTGAAGTTAAATGG - Intronic
1021768726 7:23976828-23976850 ACACACAGACTGAAGGTGAAGGG - Intergenic
1022960283 7:35419475-35419497 ACTCACTTACTGAAGCTAAAAGG + Intergenic
1023509968 7:40941931-40941953 TCTTATAGATTCAAGGTAAACGG - Intergenic
1023808661 7:43893559-43893581 ACATACAGACTGAAAGTAAAAGG + Intronic
1023947660 7:44816461-44816483 TCTCACAGGCTGAAGTACAATGG + Intronic
1024008065 7:45241827-45241849 ACTCAGAGACTGAAGGGAGACGG - Intergenic
1024174939 7:46829479-46829501 TCACACAAACTTAAGGTAAAGGG + Intergenic
1024452695 7:49565818-49565840 ACTCACAGGCTCAAAGTAAAAGG + Intergenic
1024847617 7:53666457-53666479 TCACATAAACTTAAGGTAAAGGG - Intergenic
1024863243 7:53871245-53871267 TCATATAGACTCAAGGTAAAGGG + Intergenic
1024975110 7:55106409-55106431 TGCCACAGAATGAAGGGAAAAGG - Intronic
1026430778 7:70345090-70345112 TCTTTCAGACTGTAGGTAATGGG - Intronic
1027328834 7:77069868-77069890 TCACATAAACTTAAGGTAAAGGG - Intergenic
1027637740 7:80696288-80696310 TCACATAGCCTGAAAGTAAAAGG + Intergenic
1027963677 7:84979199-84979221 TTGCACAAACTTAAGGTAAAGGG - Intergenic
1028033369 7:85947789-85947811 ACACACAGACTGAAAATAAAGGG - Intergenic
1028036997 7:85997036-85997058 GCACACAGACTGAAAATAAAGGG - Intergenic
1028197990 7:87929028-87929050 TCACATAAACTTAAGGTAAAGGG + Intergenic
1028261866 7:88676049-88676071 TCACATAAACTTAAGGTAAAGGG + Intergenic
1028339274 7:89697760-89697782 ACACACAGACTGAAAATAAAGGG + Intergenic
1028488163 7:91382582-91382604 TATGACAGACAGAACGTAAATGG + Intergenic
1028543334 7:91969771-91969793 GCGCACAGACTGAAAGTGAAGGG - Intronic
1028768287 7:94585508-94585530 TCTTACACATTGCAGGTAAATGG - Exonic
1028819321 7:95188348-95188370 TCACATAAACTTAAGGTAAAGGG - Intronic
1028822732 7:95231032-95231054 TCACATAAACTTAAGGTAAAGGG + Intronic
1028936673 7:96472604-96472626 TCACATAAACTTAAGGTAAAGGG - Intergenic
1029070660 7:97893501-97893523 ACACACAGACTGAAAGTGAAGGG + Intergenic
1029786934 7:102801513-102801535 TCACATAAACTTAAGGTAAAGGG + Intronic
1029867137 7:103645405-103645427 ACTTACAGACTAAAGATAAAGGG + Intronic
1030390251 7:108919204-108919226 TCACACAAACTTAAGGTAAAGGG - Intergenic
1030440679 7:109584562-109584584 ACCTACAGACTCAAGGTAAAGGG + Intergenic
1030533640 7:110739339-110739361 TCACATAAACTTAAGGTAAAGGG + Intronic
1031090241 7:117346111-117346133 TCACATAAACTTAAGGTAAAGGG - Intergenic
1031139070 7:117921155-117921177 TCACATAAACTTAAGGTAAAGGG + Intergenic
1031426857 7:121615685-121615707 CTTTACAGACTGAAGGTTAAAGG + Intergenic
1031676995 7:124622799-124622821 ACACAAAGACTGAAGGTGAAGGG + Intergenic
1032265905 7:130369868-130369890 TTTCACAGGCTGAATGGAAAGGG - Intergenic
1032288899 7:130568338-130568360 TCACATAAACTTAAGGTAAAGGG + Intronic
1032928546 7:136638202-136638224 TCTCACTTACTGAAGAGAAATGG + Intergenic
1033025432 7:137767361-137767383 TCTCCCAGAATGTAGGTCAAAGG + Intronic
1033623088 7:143079849-143079871 TCACATAAACTTAAGGTAAAAGG + Intergenic
1033677172 7:143554232-143554254 ACACACAGACTGAAAGAAAAAGG - Intergenic
1033694663 7:143775205-143775227 ACACACAGACTGAAAGAAAAAGG + Intergenic
1034019753 7:147628750-147628772 TCACATAAACTTAAGGTAAAGGG + Intronic
1034705305 7:153137711-153137733 TCACATAAACTTAAGGTAAAGGG - Intergenic
1035143962 7:156794384-156794406 CCTTACAGACTTAAGGTCAAAGG - Intronic
1035451184 7:158977896-158977918 TCACAGAGACAGAAGGTAGAAGG - Intergenic
1035653921 8:1291295-1291317 TCTCATGGACTCAAGATAAAGGG + Intergenic
1036076151 8:5503076-5503098 TCACAGAAACAGAAGGTAAAAGG - Intergenic
1036108600 8:5873357-5873379 TCACATAAACTCAAGGTAAAGGG - Intergenic
1036247908 8:7136265-7136287 ACACACAGACTGAAAGTGAAGGG - Intergenic
1036252903 8:7178096-7178118 ACACACAGACTGAAAGTGAAGGG + Intergenic
1036285311 8:7439742-7439764 TCACACAGGCTGAAAGTAAAGGG - Intergenic
1036336165 8:7871787-7871809 TCACACAGGCTGAAAGTAAAGGG + Intergenic
1036364594 8:8109366-8109388 ACACACAGACTGAAAGTGAAGGG - Intergenic
1036666787 8:10750231-10750253 TGACAGAGACTGAATGTAAAAGG - Intronic
1036886347 8:12556759-12556781 ACACACAGACTGAAAGTGAAGGG + Intergenic
1036893955 8:12615829-12615851 ACACACAGACTGAAAGTGAAGGG + Intergenic
1036913615 8:12783130-12783152 ACACACAGACTGAAAGTAAAGGG - Intergenic
1037697846 8:21242851-21242873 ACACATAGACTGAAAGTAAAGGG - Intergenic
1038469157 8:27797439-27797461 TCACATAGACTGAAAGTGAAGGG - Intronic
1039030294 8:33301461-33301483 TCACATAAACTTAAGGTAAAAGG + Intergenic
1039420918 8:37439215-37439237 ACACACAGACTGAAAATAAAGGG - Intergenic
1039623241 8:39021320-39021342 TCTCCCAGACTGGAGTGAAATGG + Intronic
1039642550 8:39239701-39239723 TCACATAAACTTAAGGTAAAGGG + Intronic
1039672526 8:39618072-39618094 ACACATAGACTGAAAGTAAATGG + Intronic
1039763681 8:40606038-40606060 TCACATAAACTGAAGGTAAAGGG - Intronic
1039810310 8:41042174-41042196 TCACATAAACTTAAGGTAAAGGG - Intergenic
1040715867 8:50251501-50251523 ACAGACAGACTGAAAGTAAAAGG + Intronic
1040989365 8:53333288-53333310 TCACATAAACTTAAGGTAAAGGG - Intergenic
1041150513 8:54927701-54927723 TCACATAAACTTAAGGTAAAGGG + Intergenic
1041832221 8:62166824-62166846 TCACATAAACTGAATGTAAAGGG + Intergenic
1042084386 8:65091679-65091701 TCACATAAACTTAAGGTAAAGGG + Intergenic
1042088800 8:65135732-65135754 ACTCACAAACTTAAAGTAAAAGG + Intergenic
1042145853 8:65729931-65729953 TCCCACACACAGAAGGCAAAAGG + Intronic
1042726586 8:71885498-71885520 ACTCATAGACTGAAAATAAAGGG - Intronic
1042768241 8:72350863-72350885 TCACATAAACTTAAGGTAAAGGG - Intergenic
1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG + Intronic
1043040976 8:75261461-75261483 TCACACAAACTTAAGGTAAAGGG + Intergenic
1043048863 8:75360284-75360306 TCTCACCAACTTAAGGTAAAGGG + Intergenic
1043116275 8:76257368-76257390 ACATACAGACTGAAAGTAAAGGG + Intergenic
1043876176 8:85489397-85489419 TCACATAAACTTAAGGTAAAGGG - Intergenic
1043985648 8:86692592-86692614 TCACATAAACTTAAGGTAAAGGG - Intronic
1043988037 8:86716994-86717016 TCACATAAACTTAAGGTAAAGGG + Intronic
1044304726 8:90625964-90625986 TCTCAAAGATGGTAGGTAAAGGG + Intronic
1044657144 8:94560736-94560758 TCACATAAACTTAAGGTAAAGGG - Intergenic
1044879665 8:96711190-96711212 TCTAATAAACTCAAGGTAAAGGG - Intronic
1044907438 8:97019501-97019523 TCACATAAACTTAAGGTAAACGG + Intronic
1045122109 8:99049026-99049048 TCACATAAACTTAAGGTAAAGGG - Intronic
1045265927 8:100618667-100618689 ACTCACAAAGTGAAGGAAAATGG + Intronic
1045590199 8:103585006-103585028 ACACACAGACTGAAAATAAAGGG + Intronic
1045878129 8:107006333-107006355 TCACATAAACTTAAGGTAAAGGG + Intergenic
1045945571 8:107791339-107791361 ACACAGAGACTGAAGGTAAAAGG + Intergenic
1046075565 8:109307748-109307770 TCACATAAACTTAAGGTAAAAGG + Intronic
1046233226 8:111385677-111385699 TCCTATAGACTCAAGGTAAAGGG - Intergenic
1046449607 8:114371100-114371122 TCACACAGGCTGGAGTTAAATGG - Intergenic
1047103676 8:121709152-121709174 ACTCACCTACTGAGGGTAAAGGG + Intergenic
1047121535 8:121910184-121910206 TCACATAGACTGAAAATAAAGGG + Intergenic
1047383998 8:124392406-124392428 TCTTATAAACTCAAGGTAAAGGG - Intergenic
1047563819 8:126018780-126018802 TCTCACTGACTGAATGTCACTGG + Intergenic
1047592204 8:126338479-126338501 TCACATAAACTTAAGGTAAAGGG + Intergenic
1047607094 8:126486133-126486155 TCACATAAACTTAAGGTAAAGGG - Intergenic
1047798161 8:128279257-128279279 TCACATAAACTTAAGGTAAATGG + Intergenic
1047937227 8:129794615-129794637 TCACATAAACTCAAGGTAAAGGG - Intergenic
1048159310 8:131998769-131998791 TTTGAGAGACTCAAGGTAAAAGG + Intronic
1048530847 8:135248982-135249004 TCACATAAACTTAAGGTAAAGGG - Intergenic
1049186695 8:141258849-141258871 TCTCGCAGACTGGAGTTCAATGG - Intronic
1049897899 9:127544-127566 TCACATAAACTTAAGGTAAAGGG - Intronic
1050379935 9:5017961-5017983 ACACATAGACTGAAAGTAAAGGG - Intronic
1050734254 9:8745479-8745501 TCTCACTGAATGAAGGTATTTGG + Intronic
1050987945 9:12106439-12106461 TCACATAAACTTAAGGTAAAGGG + Intergenic
1051601160 9:18876106-18876128 TCACATAAACTTAAGGTAAAGGG - Intronic
1051832976 9:21301286-21301308 ACTCACAGGCTCAACGTAAAGGG + Intergenic
1051840178 9:21387606-21387628 ACATATAGACTGAAGGTAAAGGG - Intergenic
1051881356 9:21843040-21843062 TCACAAAAACTTAAGGTAAAAGG + Intronic
1052006470 9:23355811-23355833 TCACATAAACTTAAGGTAAAGGG - Intergenic
1052218511 9:25994471-25994493 TCACATAAACTTAAGGTAAAGGG + Intergenic
1052307428 9:27026111-27026133 TCACATAAACTTAAGGTAAAAGG + Intronic
1052550072 9:29937071-29937093 TCACATAAACTTAAGGTAAAAGG - Intergenic
1052590956 9:30494224-30494246 ACATACAGACTGAAAGTAAAGGG + Intergenic
1053126752 9:35587290-35587312 TCACATAAACTTAAGGTAAAGGG + Intergenic
1053386451 9:37694404-37694426 TCTCACAGACTGTAAATGAAAGG + Intronic
1053563727 9:39224565-39224587 ACACACAGACTGAAAGCAAAGGG - Intronic
1053631295 9:39942750-39942772 TCTCATAGACTCAAGGTAAGGGG - Intergenic
1053740979 9:41137837-41137859 TCACATAAACTTAAGGTAAAGGG - Intronic
1053774469 9:41520783-41520805 TCTCATAGACTCAAGGTAAGGGG + Intergenic
1054133420 9:61394502-61394524 ACACACAGACTGAAAGCAAAGGG + Intergenic
1054212592 9:62307948-62307970 TCTCATAGACTCAAGGTAAGGGG + Intergenic
1054443967 9:65293980-65294002 TCACATAAACTTAAGGTAAAGGG - Intergenic
1054486306 9:65727526-65727548 TCACATAAACTTAAGGTAAAGGG + Intronic
1054687370 9:68293460-68293482 TCACATAAACTTAAGGTAAAGGG + Intronic
1054844620 9:69780760-69780782 TCACATAAACTTAAGGTAAAGGG - Intergenic
1055138104 9:72846196-72846218 TCACATAAACTTAAGGTAAAGGG + Intergenic
1055156503 9:73068833-73068855 TCACATAAACTTAAGGTAAACGG + Intronic
1056026874 9:82506900-82506922 TCACATAAACTTAAGGTAAAGGG + Intergenic
1056309632 9:85326302-85326324 TCACATAAACTTAAGGTAAAGGG + Intergenic
1056696395 9:88858152-88858174 TCACATAAACTTAAGGTAAAGGG + Intergenic
1056948265 9:91019598-91019620 TCACATAAACTTAAGGTAAAGGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057475907 9:95401281-95401303 TCACATAAACTTAAGGTAAAGGG + Intergenic
1058030396 9:100190246-100190268 TCTTACAGACTCAAGGTAAAGGG - Intronic
1058246307 9:102630297-102630319 ACCCACAGACTCAAAGTAAAGGG - Intergenic
1058540501 9:106007498-106007520 TTGCACAAACTTAAGGTAAAGGG - Intergenic
1058648300 9:107151268-107151290 TCTCACAGCCTGAAGGAGAAGGG + Intergenic
1058784369 9:108372606-108372628 TCACATAAACTTAAGGTAAAGGG - Intergenic
1059719224 9:116943151-116943173 GCTCATAGACTGAAGGGAAGGGG + Intronic
1060314262 9:122494547-122494569 TCACATACACTTAAGGTAAAGGG - Intergenic
1061651689 9:132055298-132055320 TCTCCCAGACTGAATCTATAAGG + Intronic
1203362655 Un_KI270442v1:231139-231161 TCTCACTAAATGAAGATAAAGGG + Intergenic
1185667833 X:1781486-1781508 TCTCACAGAACACAGGTAAATGG - Intergenic
1186014613 X:5177051-5177073 TCACACAGATTGGAGGAAAATGG - Intergenic
1186525782 X:10247091-10247113 TGGCACAGACTGGAGGGAAATGG - Intergenic
1187589048 X:20695429-20695451 TCACATAAACTTAAGGTAAAGGG + Intergenic
1187809436 X:23158825-23158847 TCTCAGAGACTAAAAATAAATGG + Intergenic
1187941268 X:24384507-24384529 ACACATAGACTGAAAGTAAAGGG - Intergenic
1188040326 X:25364459-25364481 TCACACAAACTTAAGGTAAAGGG - Intergenic
1188371671 X:29377223-29377245 CCCCACAGACTCAAAGTAAAGGG - Intronic
1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG + Intergenic
1188733803 X:33686408-33686430 ACACACAGACTGAAATTAAAGGG - Intergenic
1188743965 X:33818790-33818812 ACACATAGACTGAAAGTAAAAGG - Intergenic
1188745096 X:33831478-33831500 TCTGGCAGAGTGAAGGGAAAGGG - Intergenic
1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG + Intergenic
1188998864 X:36920995-36921017 ACACACAGACTGAAAATAAAAGG - Intergenic
1189564417 X:42226285-42226307 ACACATAGACTGAAAGTAAAGGG - Intergenic
1189663058 X:43324398-43324420 TCACATAAACTTAAGGTAAAGGG - Intergenic
1189769283 X:44407457-44407479 ACACACAGACTGAAAGTGAAAGG - Intergenic
1189945807 X:46177436-46177458 TCACATAAACTTAAGGTAAAGGG - Intergenic
1190701879 X:52995462-52995484 TGTCACAAACTGAAGGCCAATGG + Intronic
1190897129 X:54631631-54631653 TCACATAAACTTAAGGTAAAGGG - Intergenic
1191077106 X:56466938-56466960 TCACAGAAACTTAAGGTAAAGGG - Intergenic
1191088658 X:56597118-56597140 TCTCCCAGACAGGAGGTACAGGG + Intergenic
1191202502 X:57799114-57799136 TCACACACATTGAATGTAAATGG + Intergenic
1191741711 X:64442953-64442975 TCATATAGACTTAAGGTAAAGGG + Intergenic
1191784348 X:64901660-64901682 ACTCATAAACTTAAGGTAAAGGG - Intergenic
1191806856 X:65145334-65145356 TCACACAAACTTAAGGTAAAGGG - Intergenic
1191836755 X:65471372-65471394 TCTTATAGACTCAAGATAAATGG - Intronic
1191917421 X:66217811-66217833 TCACATAAACTTAAGGTAAAAGG + Intronic
1191945021 X:66524182-66524204 TCACATAAACTTAAGGTAAAGGG - Intergenic
1192013547 X:67301928-67301950 TCACATAGACTGAAGGTGAAGGG + Intergenic
1192164166 X:68814844-68814866 TCACAAAAACTTAAGGTAAAAGG + Intergenic
1192406341 X:70890058-70890080 ACACACAGACTGAAAATAAAGGG + Intronic
1192531494 X:71891038-71891060 TCACAGAGACAGAAAGTAAAAGG - Intergenic
1192609845 X:72556527-72556549 TTACATAAACTGAAGGTAAAGGG + Intronic
1192633812 X:72799201-72799223 ACACACAGACTGAAAGCAAAGGG - Intronic
1192647898 X:72921600-72921622 ACACACAGACTGAAAGCAAAGGG + Intronic
1192878330 X:75255636-75255658 TCACATAAAATGAAGGTAAAGGG + Intergenic
1192904156 X:75532292-75532314 TTTTATAGACTCAAGGTAAAAGG - Intergenic
1192978810 X:76316956-76316978 TCTCATAAACTTAAAGTAAAAGG - Intergenic
1192991676 X:76465735-76465757 TCACAGAAACTTAAGGTAAAGGG - Intergenic
1193078148 X:77377122-77377144 TCACATAAACTTAAGGTAAAGGG + Intergenic
1193159561 X:78213511-78213533 TCTCGCACACTGATGGTCAAAGG + Intergenic
1193354570 X:80502510-80502532 TCTTATAGACTCAAGGTAAAGGG + Intergenic
1193428237 X:81367611-81367633 TCTCCCAGGCTGAAGTTAAGTGG + Intergenic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1193590888 X:83387496-83387518 TCACAGAAACTTAAGGTAAAGGG + Intergenic
1193618869 X:83725957-83725979 TCACATAAACTTAAGGTAAAGGG + Intergenic
1193632038 X:83901353-83901375 TCACACAAACTTAAGGCAAAGGG + Intergenic
1193664824 X:84302756-84302778 ACACATAGACTGAAAGTAAAGGG + Intergenic
1193699833 X:84747233-84747255 GGGCACAGACTGAAGATAAATGG - Intergenic
1193721778 X:84995417-84995439 ACACATAGACTGAAGGTAAAAGG + Intergenic
1193723412 X:85014188-85014210 TCACATATACTTAAGGTAAAGGG - Intronic
1193747128 X:85296103-85296125 ACCCACAGACTCAAAGTAAAGGG - Intronic
1193775765 X:85640128-85640150 TCACATAAACTTAAGGTAAAGGG - Intergenic
1193785820 X:85758761-85758783 TCACATACACTTAAGGTAAAGGG - Intergenic
1193791829 X:85823669-85823691 TCACACAAACTTAAGGTAAAGGG + Intergenic
1193821266 X:86168401-86168423 ACACAAAGACTGAAGCTAAAGGG - Intronic
1194058587 X:89167610-89167632 TCACATAAACTTAAGGTAAAGGG + Intergenic
1194103425 X:89736696-89736718 TCACAAAAACTTAAGGTAAAGGG - Intergenic
1194106941 X:89781120-89781142 ACACATAGACTGAAAGTAAAGGG + Intergenic
1194147128 X:90278726-90278748 CCTCACAGACAGAGGGTACAAGG - Intergenic
1194181770 X:90718825-90718847 TCACATAAACTTAAGGTAAAGGG + Intergenic
1194218561 X:91163942-91163964 ACACACAGACTGAAAATAAAGGG - Intergenic
1194232159 X:91337574-91337596 TCACATAAACTTAAGGTAAAGGG + Intergenic
1194443868 X:93963951-93963973 ACCCACAGACTCAAAGTAAAGGG - Intergenic
1194596557 X:95866272-95866294 TCATACAAACTCAAGGTAAAAGG + Intergenic
1194606420 X:95984658-95984680 TCACATAAACTTAAGGTAAAGGG - Intergenic
1194630465 X:96276423-96276445 TCACATAAACTTAAGGTAAAAGG + Intergenic
1194868084 X:99094351-99094373 TCACATAAACTTAAGGTAAAGGG - Intergenic
1194888187 X:99345630-99345652 ACCCACAGACTTAAAGTAAAGGG - Intergenic
1194967541 X:100305694-100305716 TCACATAAACTTAAGGTAAAGGG + Intronic
1195237318 X:102913466-102913488 TCACATAAACTTAAGGTAAAGGG + Intergenic
1195984973 X:110619905-110619927 TCACAAAAACTTAAGGTAAAGGG - Intergenic
1196024195 X:111022812-111022834 TCACATAAACTTAAGGTAAAGGG + Intronic
1196224977 X:113156090-113156112 TCGCACAAACTTAAGGTAAAGGG - Intergenic
1196477873 X:116110175-116110197 TCACACAAACTTAAGGTAAAGGG - Intergenic
1196550657 X:117020024-117020046 AGTTACAGACTCAAGGTAAAAGG + Intergenic
1196948019 X:120848139-120848161 TCACACAAACTTAAGGTACAGGG - Intergenic
1197027906 X:121777585-121777607 TCTTGTAGACTGAAGGTAAAGGG - Intergenic
1197054456 X:122099564-122099586 TCACATAAACTTAAGGTAAAGGG - Intergenic
1197081557 X:122424605-122424627 TCACATAAACTTAAGGTAAAGGG - Intergenic
1197363770 X:125538287-125538309 TCACATAAACTAAAGGTAAAGGG + Intergenic
1197504106 X:127280192-127280214 TCACATAAACTTAAGGTAAAGGG + Intergenic
1197545458 X:127818158-127818180 TCACATAAACTTAAGGTAAAGGG + Intergenic
1197571982 X:128161359-128161381 TCACATAAACTTAAGGTAAAGGG - Intergenic
1197574264 X:128189848-128189870 TCACATAAACTTAAGGTAAAGGG + Intergenic
1197911186 X:131483940-131483962 TCACATAAACTTAAGGTAAAGGG + Intergenic
1198559680 X:137836083-137836105 TCACATAAACTTAAGGTAAAGGG - Intergenic
1198619481 X:138490366-138490388 TCTCAGTGACTGCAGATAAAGGG + Intergenic
1198696057 X:139339542-139339564 TCACATAAACTTAAGGTAAAGGG - Intergenic
1198712666 X:139522831-139522853 TCACATAAACTTAAGGTAAAGGG + Intergenic
1198797082 X:140408776-140408798 TCACATAAACTTAAGGTAAAGGG - Intergenic
1199415335 X:147575642-147575664 ACACACAGACTGAAGACAAAGGG + Intergenic
1199442761 X:147887222-147887244 ACACACAGACTGAAAATAAAGGG - Intergenic
1200379762 X:155822507-155822529 ACACACAGACTGAAAATAAAGGG + Intergenic
1200458904 Y:3428979-3429001 ACACATAGACTGAAAGTAAAGGG + Intergenic
1200493531 Y:3855494-3855516 CCTCACAGACAGAGGGTACAAGG - Intergenic
1200528393 Y:4300741-4300763 TCACATAAACTTAAGGTAAAGGG + Intergenic
1200555074 Y:4627699-4627721 ACACACAGACTGAAAATAAAGGG - Intergenic
1200579115 Y:4926647-4926669 ACACACAGACTCAAAGTAAAGGG + Intergenic