ID: 1131829204

View in Genome Browser
Species Human (GRCh38)
Location 15:96343712-96343734
Sequence GGGCTTCTAGGCGAAGCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131829202_1131829204 -4 Left 1131829202 15:96343693-96343715 CCGGCAAAGCTCGGGGACTGGGC No data
Right 1131829204 15:96343712-96343734 GGGCTTCTAGGCGAAGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131829204 Original CRISPR GGGCTTCTAGGCGAAGCTAA TGG Intergenic
No off target data available for this crispr