ID: 1131829660

View in Genome Browser
Species Human (GRCh38)
Location 15:96345934-96345956
Sequence TCCCGGCCACGCCTGCGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131829660_1131829663 10 Left 1131829660 15:96345934-96345956 CCAAATCGCAGGCGTGGCCGGGA No data
Right 1131829663 15:96345967-96345989 CTGCAGCATACAGCTGGCCGAGG No data
1131829660_1131829667 21 Left 1131829660 15:96345934-96345956 CCAAATCGCAGGCGTGGCCGGGA No data
Right 1131829667 15:96345978-96346000 AGCTGGCCGAGGGGGAGCCGCGG No data
1131829660_1131829666 13 Left 1131829660 15:96345934-96345956 CCAAATCGCAGGCGTGGCCGGGA No data
Right 1131829666 15:96345970-96345992 CAGCATACAGCTGGCCGAGGGGG No data
1131829660_1131829665 12 Left 1131829660 15:96345934-96345956 CCAAATCGCAGGCGTGGCCGGGA No data
Right 1131829665 15:96345969-96345991 GCAGCATACAGCTGGCCGAGGGG No data
1131829660_1131829662 4 Left 1131829660 15:96345934-96345956 CCAAATCGCAGGCGTGGCCGGGA No data
Right 1131829662 15:96345961-96345983 TCGCTTCTGCAGCATACAGCTGG No data
1131829660_1131829668 22 Left 1131829660 15:96345934-96345956 CCAAATCGCAGGCGTGGCCGGGA No data
Right 1131829668 15:96345979-96346001 GCTGGCCGAGGGGGAGCCGCGGG No data
1131829660_1131829669 25 Left 1131829660 15:96345934-96345956 CCAAATCGCAGGCGTGGCCGGGA No data
Right 1131829669 15:96345982-96346004 GGCCGAGGGGGAGCCGCGGGTGG No data
1131829660_1131829664 11 Left 1131829660 15:96345934-96345956 CCAAATCGCAGGCGTGGCCGGGA No data
Right 1131829664 15:96345968-96345990 TGCAGCATACAGCTGGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131829660 Original CRISPR TCCCGGCCACGCCTGCGATT TGG (reversed) Intergenic