ID: 1131830527

View in Genome Browser
Species Human (GRCh38)
Location 15:96352111-96352133
Sequence CCGCGCCTGGCCCCTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131830517_1131830527 13 Left 1131830517 15:96352075-96352097 CCCCGGGGGGGTGGGGCGTGGAG No data
Right 1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG No data
1131830518_1131830527 12 Left 1131830518 15:96352076-96352098 CCCGGGGGGGTGGGGCGTGGAGG No data
Right 1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG No data
1131830520_1131830527 11 Left 1131830520 15:96352077-96352099 CCGGGGGGGTGGGGCGTGGAGGG No data
Right 1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131830527 Original CRISPR CCGCGCCTGGCCCCTGCCCT GGG Intergenic
No off target data available for this crispr