ID: 1131831857

View in Genome Browser
Species Human (GRCh38)
Location 15:96359718-96359740
Sequence ACAGTCTCCTCGCCAACTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131831857_1131831870 22 Left 1131831857 15:96359718-96359740 CCCGAAGTTGGCGAGGAGACTGT No data
Right 1131831870 15:96359763-96359785 CCGCCGGGTGGCTCCAGAAATGG No data
1131831857_1131831862 -9 Left 1131831857 15:96359718-96359740 CCCGAAGTTGGCGAGGAGACTGT No data
Right 1131831862 15:96359732-96359754 GGAGACTGTGCCGGGTGTTCGGG No data
1131831857_1131831865 7 Left 1131831857 15:96359718-96359740 CCCGAAGTTGGCGAGGAGACTGT No data
Right 1131831865 15:96359748-96359770 GTTCGGGCAAATGCCCCGCCGGG No data
1131831857_1131831864 6 Left 1131831857 15:96359718-96359740 CCCGAAGTTGGCGAGGAGACTGT No data
Right 1131831864 15:96359747-96359769 TGTTCGGGCAAATGCCCCGCCGG No data
1131831857_1131831866 10 Left 1131831857 15:96359718-96359740 CCCGAAGTTGGCGAGGAGACTGT No data
Right 1131831866 15:96359751-96359773 CGGGCAAATGCCCCGCCGGGTGG No data
1131831857_1131831861 -10 Left 1131831857 15:96359718-96359740 CCCGAAGTTGGCGAGGAGACTGT No data
Right 1131831861 15:96359731-96359753 AGGAGACTGTGCCGGGTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131831857 Original CRISPR ACAGTCTCCTCGCCAACTTC GGG (reversed) Intergenic
No off target data available for this crispr