ID: 1131832256

View in Genome Browser
Species Human (GRCh38)
Location 15:96361357-96361379
Sequence CCCCAGAGGAGAAAGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131832256_1131832273 30 Left 1131832256 15:96361357-96361379 CCTCCCCCCTTTCTCCTCTGGGG No data
Right 1131832273 15:96361410-96361432 AGCTCCTCGCATCTGGGCACAGG No data
1131832256_1131832269 24 Left 1131832256 15:96361357-96361379 CCTCCCCCCTTTCTCCTCTGGGG No data
Right 1131832269 15:96361404-96361426 AACCCCAGCTCCTCGCATCTGGG No data
1131832256_1131832268 23 Left 1131832256 15:96361357-96361379 CCTCCCCCCTTTCTCCTCTGGGG No data
Right 1131832268 15:96361403-96361425 AAACCCCAGCTCCTCGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131832256 Original CRISPR CCCCAGAGGAGAAAGGGGGG AGG (reversed) Intergenic