ID: 1131832260

View in Genome Browser
Species Human (GRCh38)
Location 15:96361361-96361383
Sequence CCTCCCCCAGAGGAGAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131832260_1131832273 26 Left 1131832260 15:96361361-96361383 CCCCCTTTCTCCTCTGGGGGAGG No data
Right 1131832273 15:96361410-96361432 AGCTCCTCGCATCTGGGCACAGG No data
1131832260_1131832269 20 Left 1131832260 15:96361361-96361383 CCCCCTTTCTCCTCTGGGGGAGG No data
Right 1131832269 15:96361404-96361426 AACCCCAGCTCCTCGCATCTGGG No data
1131832260_1131832268 19 Left 1131832260 15:96361361-96361383 CCCCCTTTCTCCTCTGGGGGAGG No data
Right 1131832268 15:96361403-96361425 AAACCCCAGCTCCTCGCATCTGG No data
1131832260_1131832274 27 Left 1131832260 15:96361361-96361383 CCCCCTTTCTCCTCTGGGGGAGG No data
Right 1131832274 15:96361411-96361433 GCTCCTCGCATCTGGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131832260 Original CRISPR CCTCCCCCAGAGGAGAAAGG GGG (reversed) Intergenic