ID: 1131832262

View in Genome Browser
Species Human (GRCh38)
Location 15:96361362-96361384
Sequence ACCTCCCCCAGAGGAGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131832262_1131832269 19 Left 1131832262 15:96361362-96361384 CCCCTTTCTCCTCTGGGGGAGGT No data
Right 1131832269 15:96361404-96361426 AACCCCAGCTCCTCGCATCTGGG No data
1131832262_1131832274 26 Left 1131832262 15:96361362-96361384 CCCCTTTCTCCTCTGGGGGAGGT No data
Right 1131832274 15:96361411-96361433 GCTCCTCGCATCTGGGCACAGGG No data
1131832262_1131832268 18 Left 1131832262 15:96361362-96361384 CCCCTTTCTCCTCTGGGGGAGGT No data
Right 1131832268 15:96361403-96361425 AAACCCCAGCTCCTCGCATCTGG No data
1131832262_1131832273 25 Left 1131832262 15:96361362-96361384 CCCCTTTCTCCTCTGGGGGAGGT No data
Right 1131832273 15:96361410-96361432 AGCTCCTCGCATCTGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131832262 Original CRISPR ACCTCCCCCAGAGGAGAAAG GGG (reversed) Intergenic