ID: 1131832265

View in Genome Browser
Species Human (GRCh38)
Location 15:96361371-96361393
Sequence AATGTGAGAACCTCCCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131832265_1131832274 17 Left 1131832265 15:96361371-96361393 CCTCTGGGGGAGGTTCTCACATT No data
Right 1131832274 15:96361411-96361433 GCTCCTCGCATCTGGGCACAGGG No data
1131832265_1131832268 9 Left 1131832265 15:96361371-96361393 CCTCTGGGGGAGGTTCTCACATT No data
Right 1131832268 15:96361403-96361425 AAACCCCAGCTCCTCGCATCTGG No data
1131832265_1131832269 10 Left 1131832265 15:96361371-96361393 CCTCTGGGGGAGGTTCTCACATT No data
Right 1131832269 15:96361404-96361426 AACCCCAGCTCCTCGCATCTGGG No data
1131832265_1131832276 24 Left 1131832265 15:96361371-96361393 CCTCTGGGGGAGGTTCTCACATT No data
Right 1131832276 15:96361418-96361440 GCATCTGGGCACAGGGCCCCAGG No data
1131832265_1131832273 16 Left 1131832265 15:96361371-96361393 CCTCTGGGGGAGGTTCTCACATT No data
Right 1131832273 15:96361410-96361432 AGCTCCTCGCATCTGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131832265 Original CRISPR AATGTGAGAACCTCCCCCAG AGG (reversed) Intergenic