ID: 1131832274

View in Genome Browser
Species Human (GRCh38)
Location 15:96361411-96361433
Sequence GCTCCTCGCATCTGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131832263_1131832274 25 Left 1131832263 15:96361363-96361385 CCCTTTCTCCTCTGGGGGAGGTT No data
Right 1131832274 15:96361411-96361433 GCTCCTCGCATCTGGGCACAGGG No data
1131832259_1131832274 28 Left 1131832259 15:96361360-96361382 CCCCCCTTTCTCCTCTGGGGGAG No data
Right 1131832274 15:96361411-96361433 GCTCCTCGCATCTGGGCACAGGG No data
1131832265_1131832274 17 Left 1131832265 15:96361371-96361393 CCTCTGGGGGAGGTTCTCACATT No data
Right 1131832274 15:96361411-96361433 GCTCCTCGCATCTGGGCACAGGG No data
1131832262_1131832274 26 Left 1131832262 15:96361362-96361384 CCCCTTTCTCCTCTGGGGGAGGT No data
Right 1131832274 15:96361411-96361433 GCTCCTCGCATCTGGGCACAGGG No data
1131832260_1131832274 27 Left 1131832260 15:96361361-96361383 CCCCCTTTCTCCTCTGGGGGAGG No data
Right 1131832274 15:96361411-96361433 GCTCCTCGCATCTGGGCACAGGG No data
1131832264_1131832274 24 Left 1131832264 15:96361364-96361386 CCTTTCTCCTCTGGGGGAGGTTC No data
Right 1131832274 15:96361411-96361433 GCTCCTCGCATCTGGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131832274 Original CRISPR GCTCCTCGCATCTGGGCACA GGG Intergenic