ID: 1131833013

View in Genome Browser
Species Human (GRCh38)
Location 15:96366260-96366282
Sequence ACTTTTACACAGGAACTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131833002_1131833013 28 Left 1131833002 15:96366209-96366231 CCCAGGCAACTTGGACCCGGTTA No data
Right 1131833013 15:96366260-96366282 ACTTTTACACAGGAACTCCAGGG No data
1131833003_1131833013 27 Left 1131833003 15:96366210-96366232 CCAGGCAACTTGGACCCGGTTAG No data
Right 1131833013 15:96366260-96366282 ACTTTTACACAGGAACTCCAGGG No data
1131833010_1131833013 1 Left 1131833010 15:96366236-96366258 CCTGTGCGGGATGTGTTTTCTGA No data
Right 1131833013 15:96366260-96366282 ACTTTTACACAGGAACTCCAGGG No data
1131833008_1131833013 13 Left 1131833008 15:96366224-96366246 CCCGGTTAGGGACCTGTGCGGGA No data
Right 1131833013 15:96366260-96366282 ACTTTTACACAGGAACTCCAGGG No data
1131833009_1131833013 12 Left 1131833009 15:96366225-96366247 CCGGTTAGGGACCTGTGCGGGAT No data
Right 1131833013 15:96366260-96366282 ACTTTTACACAGGAACTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131833013 Original CRISPR ACTTTTACACAGGAACTCCA GGG Intergenic
No off target data available for this crispr