ID: 1131833061

View in Genome Browser
Species Human (GRCh38)
Location 15:96366437-96366459
Sequence CTGGACCCTGACTTTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131833061_1131833068 30 Left 1131833061 15:96366437-96366459 CCTCCAAAAAAGTCAGGGTCCAG No data
Right 1131833068 15:96366490-96366512 GAGCAGAGCTTGAGATGAAACGG No data
1131833061_1131833066 -2 Left 1131833061 15:96366437-96366459 CCTCCAAAAAAGTCAGGGTCCAG No data
Right 1131833066 15:96366458-96366480 AGAGGAGAATTGCGAACAGGAGG No data
1131833061_1131833064 -5 Left 1131833061 15:96366437-96366459 CCTCCAAAAAAGTCAGGGTCCAG No data
Right 1131833064 15:96366455-96366477 TCCAGAGGAGAATTGCGAACAGG No data
1131833061_1131833067 5 Left 1131833061 15:96366437-96366459 CCTCCAAAAAAGTCAGGGTCCAG No data
Right 1131833067 15:96366465-96366487 AATTGCGAACAGGAGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131833061 Original CRISPR CTGGACCCTGACTTTTTTGG AGG (reversed) Intergenic
No off target data available for this crispr