ID: 1131842474

View in Genome Browser
Species Human (GRCh38)
Location 15:96452149-96452171
Sequence AGGGTTATATACTAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131842474_1131842484 26 Left 1131842474 15:96452149-96452171 CCATCCTCCTAGTATATAACCCT No data
Right 1131842484 15:96452198-96452220 TGATTTAAAACCTTGTAACTAGG No data
1131842474_1131842480 3 Left 1131842474 15:96452149-96452171 CCATCCTCCTAGTATATAACCCT No data
Right 1131842480 15:96452175-96452197 TGCAAACCTCAGCTACCTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131842474 Original CRISPR AGGGTTATATACTAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr