ID: 1131843122

View in Genome Browser
Species Human (GRCh38)
Location 15:96459038-96459060
Sequence GGGTTTGGAATGGCATGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131843122_1131843133 23 Left 1131843122 15:96459038-96459060 CCCCTCCATGCCATTCCAAACCC No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843122_1131843132 15 Left 1131843122 15:96459038-96459060 CCCCTCCATGCCATTCCAAACCC No data
Right 1131843132 15:96459076-96459098 CCTGCATTCTCCTTTCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131843122 Original CRISPR GGGTTTGGAATGGCATGGAG GGG (reversed) Intergenic
No off target data available for this crispr