ID: 1131843133

View in Genome Browser
Species Human (GRCh38)
Location 15:96459084-96459106
Sequence CTCCTTTCTATCTGGTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131843124_1131843133 21 Left 1131843124 15:96459040-96459062 CCTCCATGCCATTCCAAACCCTC No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843126_1131843133 13 Left 1131843126 15:96459048-96459070 CCATTCCAAACCCTCCTACTGCT No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843122_1131843133 23 Left 1131843122 15:96459038-96459060 CCCCTCCATGCCATTCCAAACCC No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843128_1131843133 3 Left 1131843128 15:96459058-96459080 CCCTCCTACTGCTGTGAGCCTGC No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843127_1131843133 8 Left 1131843127 15:96459053-96459075 CCAAACCCTCCTACTGCTGTGAG No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843130_1131843133 -1 Left 1131843130 15:96459062-96459084 CCTACTGCTGTGAGCCTGCATTC No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843125_1131843133 18 Left 1131843125 15:96459043-96459065 CCATGCCATTCCAAACCCTCCTA No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843123_1131843133 22 Left 1131843123 15:96459039-96459061 CCCTCCATGCCATTCCAAACCCT No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843129_1131843133 2 Left 1131843129 15:96459059-96459081 CCTCCTACTGCTGTGAGCCTGCA No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data
1131843121_1131843133 30 Left 1131843121 15:96459031-96459053 CCTTCTGCCCCTCCATGCCATTC No data
Right 1131843133 15:96459084-96459106 CTCCTTTCTATCTGGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131843133 Original CRISPR CTCCTTTCTATCTGGTCAGA TGG Intergenic
No off target data available for this crispr