ID: 1131844162

View in Genome Browser
Species Human (GRCh38)
Location 15:96471090-96471112
Sequence CATTGTGATGGGAGTCGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131844156_1131844162 0 Left 1131844156 15:96471067-96471089 CCGTTTCCAGAACCCTCAAGTCA No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844152_1131844162 12 Left 1131844152 15:96471055-96471077 CCGCCCAGTCTCCCGTTTCCAGA No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844155_1131844162 1 Left 1131844155 15:96471066-96471088 CCCGTTTCCAGAACCCTCAAGTC No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844149_1131844162 15 Left 1131844149 15:96471052-96471074 CCCCCGCCCAGTCTCCCGTTTCC No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844151_1131844162 13 Left 1131844151 15:96471054-96471076 CCCGCCCAGTCTCCCGTTTCCAG No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844150_1131844162 14 Left 1131844150 15:96471053-96471075 CCCCGCCCAGTCTCCCGTTTCCA No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844147_1131844162 25 Left 1131844147 15:96471042-96471064 CCCAGCTCTACCCCCGCCCAGTC No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844154_1131844162 8 Left 1131844154 15:96471059-96471081 CCAGTCTCCCGTTTCCAGAACCC No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844153_1131844162 9 Left 1131844153 15:96471058-96471080 CCCAGTCTCCCGTTTCCAGAACC No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844157_1131844162 -6 Left 1131844157 15:96471073-96471095 CCAGAACCCTCAAGTCACATTGT No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data
1131844148_1131844162 24 Left 1131844148 15:96471043-96471065 CCAGCTCTACCCCCGCCCAGTCT No data
Right 1131844162 15:96471090-96471112 CATTGTGATGGGAGTCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131844162 Original CRISPR CATTGTGATGGGAGTCGTGC AGG Intergenic
No off target data available for this crispr