ID: 1131846582

View in Genome Browser
Species Human (GRCh38)
Location 15:96495345-96495367
Sequence TAGGGCACAGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131846577_1131846582 -6 Left 1131846577 15:96495328-96495350 CCAGGAAGACCAGCTGCTAGGGC No data
Right 1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG No data
1131846569_1131846582 5 Left 1131846569 15:96495317-96495339 CCCACCCCAGCCCAGGAAGACCA No data
Right 1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG No data
1131846575_1131846582 -5 Left 1131846575 15:96495327-96495349 CCCAGGAAGACCAGCTGCTAGGG No data
Right 1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG No data
1131846571_1131846582 1 Left 1131846571 15:96495321-96495343 CCCCAGCCCAGGAAGACCAGCTG No data
Right 1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG No data
1131846573_1131846582 -1 Left 1131846573 15:96495323-96495345 CCAGCCCAGGAAGACCAGCTGCT No data
Right 1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG No data
1131846567_1131846582 21 Left 1131846567 15:96495301-96495323 CCAGGGGTCAGAAGAGCCCACCC No data
Right 1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG No data
1131846572_1131846582 0 Left 1131846572 15:96495322-96495344 CCCAGCCCAGGAAGACCAGCTGC No data
Right 1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG No data
1131846570_1131846582 4 Left 1131846570 15:96495318-96495340 CCACCCCAGCCCAGGAAGACCAG No data
Right 1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131846582 Original CRISPR TAGGGCACAGAGAAGGAGGA GGG Intergenic
No off target data available for this crispr