ID: 1131847692

View in Genome Browser
Species Human (GRCh38)
Location 15:96505221-96505243
Sequence GTTCCAGCACGTGGTGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131847684_1131847692 21 Left 1131847684 15:96505177-96505199 CCAGTGAAAAATCTAAGCAGTGA No data
Right 1131847692 15:96505221-96505243 GTTCCAGCACGTGGTGCAGAAGG No data
1131847689_1131847692 -10 Left 1131847689 15:96505208-96505230 CCCAGTGGGGGCAGTTCCAGCAC No data
Right 1131847692 15:96505221-96505243 GTTCCAGCACGTGGTGCAGAAGG No data
1131847683_1131847692 30 Left 1131847683 15:96505168-96505190 CCTCATTCTCCAGTGAAAAATCT No data
Right 1131847692 15:96505221-96505243 GTTCCAGCACGTGGTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131847692 Original CRISPR GTTCCAGCACGTGGTGCAGA AGG Intergenic