ID: 1131853692

View in Genome Browser
Species Human (GRCh38)
Location 15:96569585-96569607
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131853689_1131853692 -10 Left 1131853689 15:96569572-96569594 CCACTATCTGTTCTCCCCACAGC No data
Right 1131853692 15:96569585-96569607 TCCCCACAGCCCTCCGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131853692 Original CRISPR TCCCCACAGCCCTCCGTGAG GGG Intergenic
No off target data available for this crispr