ID: 1131855698

View in Genome Browser
Species Human (GRCh38)
Location 15:96591250-96591272
Sequence CCATTGCAACAAATTTACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131855698_1131855703 9 Left 1131855698 15:96591250-96591272 CCTCAGTAAATTTGTTGCAATGG No data
Right 1131855703 15:96591282-96591304 AAAACCCAGAACTTAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131855698 Original CRISPR CCATTGCAACAAATTTACTG AGG (reversed) Intergenic
No off target data available for this crispr