ID: 1131857722

View in Genome Browser
Species Human (GRCh38)
Location 15:96616578-96616600
Sequence CAGGGAGACCAAAGGCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131857722_1131857728 2 Left 1131857722 15:96616578-96616600 CCTCCCGGCCTTTGGTCTCCCTG No data
Right 1131857728 15:96616603-96616625 AATTGCCCCTGTCTAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131857722 Original CRISPR CAGGGAGACCAAAGGCCGGG AGG (reversed) Intergenic
No off target data available for this crispr