ID: 1131857891

View in Genome Browser
Species Human (GRCh38)
Location 15:96618012-96618034
Sequence TAGGGTCTTCAGAGGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131857879_1131857891 20 Left 1131857879 15:96617969-96617991 CCAAGACGTTCAGTTTGGGGAGA No data
Right 1131857891 15:96618012-96618034 TAGGGTCTTCAGAGGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131857891 Original CRISPR TAGGGTCTTCAGAGGGGACA GGG Intergenic
No off target data available for this crispr