ID: 1131858046 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:96620009-96620031 |
| Sequence | ACTGATATTCAGGCTGTGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131858042_1131858046 | 17 | Left | 1131858042 | 15:96619969-96619991 | CCAATGATCTACATGTATCCATT | No data | ||
| Right | 1131858046 | 15:96620009-96620031 | ACTGATATTCAGGCTGTGCTTGG | No data | ||||
| 1131858041_1131858046 | 21 | Left | 1131858041 | 15:96619965-96619987 | CCAGCCAATGATCTACATGTATC | No data | ||
| Right | 1131858046 | 15:96620009-96620031 | ACTGATATTCAGGCTGTGCTTGG | No data | ||||
| 1131858043_1131858046 | -1 | Left | 1131858043 | 15:96619987-96620009 | CCATTTCAGTAAATGTTCATCCA | No data | ||
| Right | 1131858046 | 15:96620009-96620031 | ACTGATATTCAGGCTGTGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131858046 | Original CRISPR | ACTGATATTCAGGCTGTGCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||