ID: 1131858046

View in Genome Browser
Species Human (GRCh38)
Location 15:96620009-96620031
Sequence ACTGATATTCAGGCTGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131858042_1131858046 17 Left 1131858042 15:96619969-96619991 CCAATGATCTACATGTATCCATT No data
Right 1131858046 15:96620009-96620031 ACTGATATTCAGGCTGTGCTTGG No data
1131858041_1131858046 21 Left 1131858041 15:96619965-96619987 CCAGCCAATGATCTACATGTATC No data
Right 1131858046 15:96620009-96620031 ACTGATATTCAGGCTGTGCTTGG No data
1131858043_1131858046 -1 Left 1131858043 15:96619987-96620009 CCATTTCAGTAAATGTTCATCCA No data
Right 1131858046 15:96620009-96620031 ACTGATATTCAGGCTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131858046 Original CRISPR ACTGATATTCAGGCTGTGCT TGG Intergenic
No off target data available for this crispr