ID: 1131862725

View in Genome Browser
Species Human (GRCh38)
Location 15:96671457-96671479
Sequence CTGGATGTCCTCATTTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131862725_1131862733 15 Left 1131862725 15:96671457-96671479 CCTTCATAAATGAGGACATCCAG No data
Right 1131862733 15:96671495-96671517 CATGTTTAGCAGTAAGTAGCGGG No data
1131862725_1131862735 17 Left 1131862725 15:96671457-96671479 CCTTCATAAATGAGGACATCCAG No data
Right 1131862735 15:96671497-96671519 TGTTTAGCAGTAAGTAGCGGGGG No data
1131862725_1131862732 14 Left 1131862725 15:96671457-96671479 CCTTCATAAATGAGGACATCCAG No data
Right 1131862732 15:96671494-96671516 CCATGTTTAGCAGTAAGTAGCGG No data
1131862725_1131862734 16 Left 1131862725 15:96671457-96671479 CCTTCATAAATGAGGACATCCAG No data
Right 1131862734 15:96671496-96671518 ATGTTTAGCAGTAAGTAGCGGGG No data
1131862725_1131862736 21 Left 1131862725 15:96671457-96671479 CCTTCATAAATGAGGACATCCAG No data
Right 1131862736 15:96671501-96671523 TAGCAGTAAGTAGCGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131862725 Original CRISPR CTGGATGTCCTCATTTATGA AGG (reversed) Intergenic
No off target data available for this crispr