ID: 1131864680

View in Genome Browser
Species Human (GRCh38)
Location 15:96694913-96694935
Sequence CATAACATGCTGAAGGTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131864678_1131864680 -10 Left 1131864678 15:96694900-96694922 CCATGGTTAAGTACATAACATGC No data
Right 1131864680 15:96694913-96694935 CATAACATGCTGAAGGTTCACGG No data
1131864676_1131864680 2 Left 1131864676 15:96694888-96694910 CCATCAACCTGACCATGGTTAAG No data
Right 1131864680 15:96694913-96694935 CATAACATGCTGAAGGTTCACGG No data
1131864674_1131864680 23 Left 1131864674 15:96694867-96694889 CCGGACAATCAGAAAATAATGCC No data
Right 1131864680 15:96694913-96694935 CATAACATGCTGAAGGTTCACGG No data
1131864673_1131864680 24 Left 1131864673 15:96694866-96694888 CCCGGACAATCAGAAAATAATGC No data
Right 1131864680 15:96694913-96694935 CATAACATGCTGAAGGTTCACGG No data
1131864677_1131864680 -5 Left 1131864677 15:96694895-96694917 CCTGACCATGGTTAAGTACATAA No data
Right 1131864680 15:96694913-96694935 CATAACATGCTGAAGGTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131864680 Original CRISPR CATAACATGCTGAAGGTTCA CGG Intergenic
No off target data available for this crispr