ID: 1131866270

View in Genome Browser
Species Human (GRCh38)
Location 15:96714058-96714080
Sequence GAGGTAGAAACCAAGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131866270_1131866277 19 Left 1131866270 15:96714058-96714080 CCATGCACCTTGGTTTCTACCTC No data
Right 1131866277 15:96714100-96714122 ACATTGCCATAGATTCAGCTGGG No data
1131866270_1131866276 18 Left 1131866270 15:96714058-96714080 CCATGCACCTTGGTTTCTACCTC No data
Right 1131866276 15:96714099-96714121 GACATTGCCATAGATTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131866270 Original CRISPR GAGGTAGAAACCAAGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr