ID: 1131866274

View in Genome Browser
Species Human (GRCh38)
Location 15:96714083-96714105
Sequence CAATGTCAAATAAGGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131866274_1131866277 -6 Left 1131866274 15:96714083-96714105 CCATGCTGCCTTATTTGACATTG No data
Right 1131866277 15:96714100-96714122 ACATTGCCATAGATTCAGCTGGG No data
1131866274_1131866276 -7 Left 1131866274 15:96714083-96714105 CCATGCTGCCTTATTTGACATTG No data
Right 1131866276 15:96714099-96714121 GACATTGCCATAGATTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131866274 Original CRISPR CAATGTCAAATAAGGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr